Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cell-wall-associated receptor protein kinase gene of triticum aestivum as well as expression vector and applications of cell-wall-associated receptor protein kinase gene

A technology of receptor protein and expression vector, which is applied in the field of genetic engineering to achieve the effect of improving resistance

Active Publication Date: 2019-01-29
NANJING AGRICULTURAL UNIVERSITY +1
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the Pm21 gene has been cloned (references: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu, W.Zhou, L.Gao, Z.Huang, R.Zhang, X. Wang, P. Chen, H. Wang, J.D.G. Jones, M. Karafiátová, J. Vrána, J. j. Y.Tian, ​​Y.Wu, A.Cao, Pm21 from Haynaldia villosa encodesa CC-NBS-LRR protein conferring powdery mildew resistance in wheat, Mol.Plant (2018) doi:10.1016 / j.molp.2018.02.013.), but Which genes are involved in the resistance pathway mediated by it is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell-wall-associated receptor protein kinase gene of triticum aestivum as well as expression vector and applications of cell-wall-associated receptor protein kinase gene
  • Cell-wall-associated receptor protein kinase gene of triticum aestivum as well as expression vector and applications of cell-wall-associated receptor protein kinase gene
  • Cell-wall-associated receptor protein kinase gene of triticum aestivum as well as expression vector and applications of cell-wall-associated receptor protein kinase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of a cell wall-related receptor protein kinase gene TaWAK6 in Nannong 9918

[0025] Nannong 9918 is a wheat variety containing a broad-spectrum powdery mildew resistance gene Pm21 bred by the Institute of Cytogenetics of Nanjing Agricultural University (known and public, reference: Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. High yield resistance to powdery mildew) A new wheat variety Nannong 9918. Journal of Nanjing Agricultural University, 2002, 25(4): 1438-1444), SM-1 is a powdery mildew susceptible mutant screened after Nanjing Agricultural University treated Nannong 9918 with EMS (known and public, References: Xing,P.Hu,J.Liu,K.Witek,S.Zhou,J.Xu,W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen,H .Wang,JDG Jones,M.Karafiátová,J.Vrána,J. J. Y. Tian, ​​Y. Wu, A. Cao, Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powderymildew resistance in wheat, Mol. Plant (2018) doi: 10.1016 / j.molp.2018.02.01...

Embodiment 2

[0028] Example 2 Using BMSV-VIGS system to study the powdery mildew resistance of TaWAK6

[0029] Virus Induced Gene Silencing (VIGS) means that after a virus carrying a target gene fragment infects a plant, it can induce silencing of plant endogenous genes and cause phenotypic changes, and then study the function of target genes based on phenotypic variation. Compared with traditional gene function analysis methods, VIGS can quickly silence and identify target genes to overcome functional duplication. Barley Stripe Mosaic Virus (BSMV) has been modified for gene silencing and functional verification in wheat (Reference: Zhou H, Li S, Deng Z, Wang X, Chen T, Zhang J, Chen S , Ling H, Zhang A, Wang D, Zhang X (2007) Molecular analysis of three new receptor-like kinase genes from hexaploid wheat and evidence for their participation in the wheat hypersensitive response to stripe rustfungus infection. Plant J 52:420-434).

[0030] Construction of BSMV: TaWAK6 vector amplification of Ta...

Embodiment 3

[0034] Example 3 Construction of TaWAK6 Gene Transient Expression Vector

[0035] The TaWAK6 gene cDNA cloned in Nannong 9918 induced by powdery mildew was used as a template, and the primer pair TaWAK6-BamHI-F (AGTCCGGAGCTAGCTCTAGAATGTCACAAGCAAAGCTCATC, SEQ ID NO. 8) and TaWAK6-KpnI-R (CCCTTGCTCACCATGGATCCTCTAGGAATTTCAG NO.9GG), SEQ ID NO. Perform PCR amplification and recover the amplified fragments. PCR program: 2μl plasmid template (100ng / ul), 2μl P3 primer (10μM), 2μl P4 primer, 25μl Phanta Max buffer (2×), 2μl dNTP Mix (10mM), 1μl Phanta Max Super-Fidelity DNA polymerase( 1U / μl) (Vazyme, China), add water to 50μl. PCR reaction conditions: 95°C pre-denaturation for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 30 seconds, 35 cycles; 72°C for 5 minutes extension. The PCR product was subjected to 1.2% agarose gel electrophoresis to detect the specificity and size of the amplified band, and the specific amplified band (AP-GX-50, Axygen) was recovered. Double ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and discloses a cell-wall-associated receptor protein kinase gene TaWAK6 of triticum aestivum as well as an expression vector and applications of the cell-wall-associated receptor protein kinase gene TaWAK6. The cDNA sequence of TaWAK6 is SEQ ID NO.3 and the coded amino acid sequence is SEQ NO.4. The gene is from the common wheat (Triticum aestivum L.) Nannong 9918. The expression of TaWAK6 is enhanced in the triticum aestivum variety Nannong 9918 capable of resisting wheat powdery mildew due to the induction of blumeria graminis, and theexpression level is far higher than the expression level in the infected triticum aestivum mutant SM-1. Through the induction of the virus-mediated gene silencing technology, TaWAK6 is silenced in Nannong 9918, so that the resistance to powdery mildew is obviously reduced; and the transient expression enables the gene to transform the infected triticum aestivum mutant SM-1, so that the haustoriumindex is obviously reduced and the resistance to powdery mildew is improved. Therefore, TaWAK6 can be used for genetic engineering breeding, after TaWAK6 is imported into the triticum aestivum variety susceptible to the wheat powdery mildew, the resistance to powdery mildew of triticum aestivum is expected to be improved.

Description

Technical field [0001] The invention belongs to the field of genetic engineering, and discloses a cell wall related protein kinase gene TaWAK6 in wheat and its expression vector and application. Background technique [0002] Wheat (Triticum aestivum) is a worldwide food crop with strong adaptability and wide distribution. About 35%-40% of the world's population uses wheat as the main food, providing about 20% protein and 21% for humans. Food calories (Li Ritter, 2006). China is the world's largest wheat planting and production country, and its annual output accounts for about 17% of the world's total output; in China, wheat is the third largest food crop, and its total output is second only to rice and corn (Reference: He Zhonghu, Zhuang Qiaosheng, Cheng Shun He, et al. China's wheat industry development and technological progress[J]. Journal of Agricultural Sciences,2018(1):99-106.). my country's wheat production not only plays an important role in ensuring domestic food secur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00A01H6/46
CPCC12N9/1205C12N15/8282C12Y207/01037
Inventor 曹爱忠邢莉萍周渭皓刘佳倩曹姝琪袁璐王秀娥张瑞奇肖进王海燕张守忠
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com