Cell-wall-associated receptor protein kinase gene of triticum aestivum as well as expression vector and applications of cell-wall-associated receptor protein kinase gene
A technology of receptor protein and expression vector, which is applied in the field of genetic engineering to achieve the effect of improving resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Cloning of a cell wall-related receptor protein kinase gene TaWAK6 in Nannong 9918
[0025] Nannong 9918 is a wheat variety containing a broad-spectrum powdery mildew resistance gene Pm21 bred by the Institute of Cytogenetics of Nanjing Agricultural University (known and public, reference: Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. High yield resistance to powdery mildew) A new wheat variety Nannong 9918. Journal of Nanjing Agricultural University, 2002, 25(4): 1438-1444), SM-1 is a powdery mildew susceptible mutant screened after Nanjing Agricultural University treated Nannong 9918 with EMS (known and public, References: Xing,P.Hu,J.Liu,K.Witek,S.Zhou,J.Xu,W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen,H .Wang,JDG Jones,M.Karafiátová,J.Vrána,J. J. Y. Tian, Y. Wu, A. Cao, Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powderymildew resistance in wheat, Mol. Plant (2018) doi: 10.1016 / j.molp.2018.02.01...
Embodiment 2
[0028] Example 2 Using BMSV-VIGS system to study the powdery mildew resistance of TaWAK6
[0029] Virus Induced Gene Silencing (VIGS) means that after a virus carrying a target gene fragment infects a plant, it can induce silencing of plant endogenous genes and cause phenotypic changes, and then study the function of target genes based on phenotypic variation. Compared with traditional gene function analysis methods, VIGS can quickly silence and identify target genes to overcome functional duplication. Barley Stripe Mosaic Virus (BSMV) has been modified for gene silencing and functional verification in wheat (Reference: Zhou H, Li S, Deng Z, Wang X, Chen T, Zhang J, Chen S , Ling H, Zhang A, Wang D, Zhang X (2007) Molecular analysis of three new receptor-like kinase genes from hexaploid wheat and evidence for their participation in the wheat hypersensitive response to stripe rustfungus infection. Plant J 52:420-434).
[0030] Construction of BSMV: TaWAK6 vector amplification of Ta...
Embodiment 3
[0034] Example 3 Construction of TaWAK6 Gene Transient Expression Vector
[0035] The TaWAK6 gene cDNA cloned in Nannong 9918 induced by powdery mildew was used as a template, and the primer pair TaWAK6-BamHI-F (AGTCCGGAGCTAGCTCTAGAATGTCACAAGCAAAGCTCATC, SEQ ID NO. 8) and TaWAK6-KpnI-R (CCCTTGCTCACCATGGATCCTCTAGGAATTTCAG NO.9GG), SEQ ID NO. Perform PCR amplification and recover the amplified fragments. PCR program: 2μl plasmid template (100ng / ul), 2μl P3 primer (10μM), 2μl P4 primer, 25μl Phanta Max buffer (2×), 2μl dNTP Mix (10mM), 1μl Phanta Max Super-Fidelity DNA polymerase( 1U / μl) (Vazyme, China), add water to 50μl. PCR reaction conditions: 95°C pre-denaturation for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 30 seconds, 35 cycles; 72°C for 5 minutes extension. The PCR product was subjected to 1.2% agarose gel electrophoresis to detect the specificity and size of the amplified band, and the specific amplified band (AP-GX-50, Axygen) was recovered. Double ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap