Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A wheat cell wall-associated receptor protein kinase gene and its expression vector and application

A technology of receptor protein and expression vector, applied in the field of genetic engineering to achieve the effect of improving resistance

Active Publication Date: 2021-06-01
NANJING AGRICULTURAL UNIVERSITY +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the Pm21 gene has been cloned (references: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu, W.Zhou, L.Gao, Z.Huang, R.Zhang, X. Wang, P. Chen, H. Wang, J.D.G. Jones, M. Karafiátová, J. Vrána, J. j. Y.Tian, ​​Y.Wu, A.Cao, Pm21 from Haynaldia villosa encodesa CC-NBS-LRR protein conferring powdery mildew resistance in wheat, Mol.Plant (2018) doi:10.1016 / j.molp.2018.02.013.), but Which genes are involved in the resistance pathway mediated by it is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A wheat cell wall-associated receptor protein kinase gene and its expression vector and application
  • A wheat cell wall-associated receptor protein kinase gene and its expression vector and application
  • A wheat cell wall-associated receptor protein kinase gene and its expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of a cell wall-associated receptor protein kinase gene TaWAK6 in Nannong 9918

[0025] Nannong 9918 is a wheat variety with broad-spectrum powdery mildew resistance gene Pm21 bred by Nanjing Agricultural University (publicly known and public, reference: Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. High yield against powdery mildew) New wheat variety Nannong 9918. Journal of Nanjing Agricultural University, 2002, 25(4): 1438-1444), SM-1 is a powdery mildew-susceptible mutant obtained by Nanjing Agricultural University after treating Nannong 9918 with EMS (known and public, References: Xing,P.Hu,J.Liu,K.Witek,S.Zhou,J.Xu,W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen,H .Wang,J.D.G.Jones,M.Karafiátová,J.Vrána,J. J. Y. Tian, ​​Y. Wu, A. Cao, Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powderymildew resistance in wheat, Mol. Plant (2018) doi: 10.1016 / j.molp.2018.02.013.). In order to screen t...

Embodiment 2

[0028] Example 2 Using BMSV-VIGS system to study the powdery mildew resistance of TaWAK6

[0029] Virus-Induced Gene Silencing (VIGS) means that after a virus carrying a target gene segment infects a plant, it can induce silencing of the plant's endogenous gene and cause phenotypic changes, and then study the function of the target gene according to the phenotypic variation. Compared with traditional gene function analysis methods, VIGS can rapidly silence and functionally identify target genes to overcome functional duplications. The Barley Stripe Mosaic Virus (BSMV) has been engineered for gene silencing and functional validation in wheat (References: Zhou H, Li S, Deng Z, Wang X, Chen T, Zhang J, Chen S , Ling H, Zhang A, Wang D, Zhang X (2007) Molecular analysis of three new receptor-like kinase genes from hexaploid wheat and evidence for their participation in the wheat hypersensitive response to stripe rustfungus infection. Plant J 52:420–434).

[0030] Amplification of...

Embodiment 3

[0034] Example 3 Construction of TaWAK6 gene transient expression vector

[0035]Using powdery mildew-induced TaWAK6 gene cDNA cloned from Nannong 9918 as a template, primer pairs TaWAK6-BamHI-F (AGTCCGGAGCTAGCTCTAGAATGTCACAAGCAAAGCTCATC, SEQ ID NO.8) and TaWAK6-KpnI-R (CCCTTGCTCACCATGGATCCTCTAGGAATTTCAGATGATTGG, SEQ ID NO.9) were used as templates. PCR amplification was performed, and the amplified fragments were recovered. PCR program: 2 μl plasmid template (100ng / ul), 2 μl P3 primer (10 μM), 2 μl P4 primer, 25 μl Phanta Max buffer (2×), 2 μl dNTP Mix (10 mM), 1 μl Phanta Max Super-Fidelity DNA polymerase ( 1 U / μl) (Vazyme, China), add water to 50 μl. PCR reaction conditions: pre-denaturation at 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 30 seconds, 35 cycles; extension at 72°C for 5 minutes. PCR products were subjected to 1.2% agarose gel electrophoresis to detect the specificity and size of the amplified band, and the specific amplified band (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and discloses a cell wall-associated receptor protein kinase gene TaWAK6 in wheat, its expression vector and application. The cDNA sequence of TaWAK6 is SEQ ID NO.3 and its encoded amino acid sequence is SEQ ID NO.4. The gene is from common wheat (Triticum asetivum L.) Nannong 9918. The expression of TaWAK6 in powdery mildew-resistant wheat variety Nannong 9918 was enhanced by powdery mildew, and the expression level was much higher than that in the susceptible wheat mutant SM‑1. Induction of TaWAK6 silencing in Nannong 9918 by virus-mediated gene silencing technology can significantly reduce the resistance to powdery mildew; transient expression of the gene into the susceptible wheat mutant SM‑1 can significantly reduce the haustoria index and powdery mildew resistance sexual enhancement. Therefore, TaWAK6 can be used in genetic engineering breeding, and introducing it into wheat varieties susceptible to powdery mildew is expected to improve the powdery mildew resistance of wheat.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a cell wall-related protein kinase gene TaWAK6 in wheat, an expression vector and application thereof. Background technique [0002] Wheat (Triticum aestivum) is a worldwide food crop with strong adaptability and wide distribution. About 35%-40% of the world's population takes wheat as the main food, providing about 20% protein and 21% to human beings. Food Calories (Li Ritter, 2006). China is the world's largest country in terms of wheat planting and production, accounting for about 17% of the world's total output; wheat is the third largest food crop in China, and its total output is second only to rice and corn (References: He Zhonghu, Zhuang Qiaosheng, Cheng Shunhe, et al. China's wheat industry development and scientific and technological progress [J]. Chinese Journal of Agronomy, 2018(1):99-106.). my country's wheat production not only plays an important role in ensuring do...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00A01H6/46
CPCC12N9/1205C12N15/8282C12Y207/01037
Inventor 曹爱忠邢莉萍周渭皓刘佳倩曹姝琪袁璐王秀娥张瑞奇肖进王海燕张守忠
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com