Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Composition for detecting human CYP2D6 gene polymorphism, kit, sample processing method and application

A technology for gene polymorphism and detection reagents, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as increasing false positive rate and false negative rate, time-consuming and laborious, and increasing operation steps.

Inactive Publication Date: 2019-02-12
湖南健基生物技术有限公司
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These techniques must go through tedious nucleic acid extraction and purification processes to obtain higher purity template DNA
Increase the operation steps, time-consuming and labor-intensive, and increase the false positive rate and false negative rate caused by human error

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition for detecting human CYP2D6 gene polymorphism, kit, sample processing method and application
  • Composition for detecting human CYP2D6 gene polymorphism, kit, sample processing method and application
  • Composition for detecting human CYP2D6 gene polymorphism, kit, sample processing method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0092] Example 1 Triple detection (188 heterozygotes, 4268 homozygotes).

[0093] Using the above method to detect the sample, the results are as follows: figure 1 As shown, the genotype is 188CT, 4268CC.

[0094] exist figure 1 In the left figure of the FAM channel, the abscissa is 1-40, the interval is 1, and the ordinate is -0.33446-1.59350, the interval is 0.21422. The coordinate values ​​of the right and left images of the FAM channel are the same.

[0095] The coordinate values ​​of the CY5 channel are the same as those of the FAM channel.

[0096] In the left figure of the VIC channel, the abscissa is 1-40, the interval is 1, and the ordinate is -0.68039-1.56561, the interval is 0.249555. The coordinate values ​​of the right and left images of the VIC channel are the same.

Embodiment 2 3

[0097] Example 2 triple detection (188 homozygotes, 4268 heterozygotes)

[0098] Using the above method to detect the sample, the results are as follows: figure 2 As shown, the genotype of the sample is 188CC, 4268GC.

[0099] exist figure 2 In , the coordinate values ​​of the FAM channel and figure 1 The coordinate values ​​of the FAM channels in the two are the same.

[0100] The coordinate values ​​of the CY5 channel are the same as those of the FAM channel.

[0101] The coordinate values ​​of the VIC channel and figure 1 The coordinate values ​​of the VIC channel in the two are the same.

Embodiment 3 3

[0102] Example 3 triple detection (188 homozygotes, 4268 homozygotes)

[0103] Using the above method to detect the sample, the results are as follows: image 3 As shown, the sample genotype is 188TT, 4268GG.

[0104] exist image 3 In , the coordinate values ​​of the FAM channel and figure 1 The coordinate values ​​of the FAM channels in the two are the same.

[0105] The coordinate values ​​of the CY5 channel are the same as those of the FAM channel.

[0106] The coordinate values ​​of the VIC channel and figure 1 The coordinate values ​​of the VIC channel in the two are the same.

[0107] Hunan Jianji Biotechnology Co., Ltd.

[0108] A composition, kit, sample processing method and application for detecting human CYP2D6 gene polymorphism

[0109] 11

[0110] 1

[0111] 20

[0112] DNA

[0113] Artificial sequence

[0114] 1

[0115] gaagaggagcattgaggacc 20

[0116] 2

[0117] 20

[0118] DNA

[0119] Artificial sequence

[0120] 2

[0121] gaagaggag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a composition for detecting human CYP2D6 gene polymorphism. The composition comprises primers for detecting the polymorphism of the C188T and / or G4268C locus of the CYP2D6 gene, and the primer for detecting C188T comprises a primer with the sequence as shown in SEQ ID NO. 1, SEQ ID NO. 2 and / or SEQ ID NO.3. The primer for detecting the G4268C locus comprises a primer withthe sequence as shown in SEQ ID NO. 4, SEQ ID NO. 5 and / or SEQ ID NO.6. The primer for detecting the C188T is combined with the primer for detecting G4268C, so as to detect the polymorphism of the C188T and the G4268C at the same time; the specificity is high; the sensitiveness is good; the repeatability is good.

Description

technical field [0001] The invention belongs to the technical field of nucleic acid detection in clinical detection technology in the field of biomedicine, and specifically relates to a composition, a kit, a sample processing method and an application for detecting human CYP2D6 gene polymorphism. Background technique [0002] Polymerase chain reaction (PCR) technology is one of the most commonly used technologies in current nucleic acid detection. Among them, real-time fluorescent PCR technology using fluorescently labeled taqman probe method has been widely used in nucleic acid detection, clinical diagnosis and molecular biology research. Very mature, this technology has been applied to many industries such as laboratory research, food safety, medicine and health, but most of these technologies use a single reaction tube to detect a single target nucleotide, when multiple target nucleotides are detected in a single reaction tube Because primers and probe sequences for detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12Q1/6851
CPCC12Q1/6851C12Q1/6858C12Q1/6883C12Q2600/156C12Q2600/16C12Q2600/166C12Q2531/113C12Q2561/101C12Q2537/143C12Q2545/101
Inventor 覃武明文荻琛罗哲容李仁君
Owner 湖南健基生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com