Establishing method for fish male sterile model
A technique of male sterility and method establishment, which is applied in the field of molecular biology, can solve problems such as sterility, and achieve the effect of simple operation and time saving
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The establishment method of the fish male sterility model is to use CRISPR / Cas9 technology to knock out the meiosis-related gene spo11, the sequence number of spo11 is no:ENSDART00000005373.9; the heterozygote is fertile, and the PCR technology is used to distinguish the heterozygous self- The homozygous males and heterozygous males obtained by crossing, wherein the male individuals in the homozygous population are sterile, thereby establishing a fish male sterility model, the specific steps of the establishment method are as follows:
[0038] (1) Search the zebrafish spo11 genome sequence no: ENSDART00000005373.9 through the ensembl online database, and design a knockout target site on the first exon of the gene. The target site sequence is sequence 1: TGGAAACGGTCGACAGATGCC[AGG], in The PAM sequence is in brackets.
[0039] (2) Check whether there is a single nucleotide polymorphism (SNP) at the target site by conventional methods:
[0040] Six zebrafish were randomly...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



