Supercharge Your Innovation With Domain-Expert AI Agents!

Establishing method for fish male sterile model

A technique of male sterility and method establishment, which is applied in the field of molecular biology, can solve problems such as sterility, and achieve the effect of simple operation and time saving

Pending Publication Date: 2019-03-01
HUNAN UNIV OF ARTS & SCI
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In many years of experiments, the inventor found that knocking out a meiosis-related gene spo11 led to male-specific sterility in zebrafish, while females were almost unaffected, but no one has reported that the gene spo11 has this function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishing method for fish male sterile model
  • Establishing method for fish male sterile model
  • Establishing method for fish male sterile model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The establishment method of the fish male sterility model is to use CRISPR / Cas9 technology to knock out the meiosis-related gene spo11, the sequence number of spo11 is no:ENSDART00000005373.9; the heterozygote is fertile, and the PCR technology is used to distinguish the heterozygous self- The homozygous males and heterozygous males obtained by crossing, wherein the male individuals in the homozygous population are sterile, thereby establishing a fish male sterility model, the specific steps of the establishment method are as follows:

[0038] (1) Search the zebrafish spo11 genome sequence no: ENSDART00000005373.9 through the ensembl online database, and design a knockout target site on the first exon of the gene. The target site sequence is sequence 1: TGGAAACGGTCGACAGATGCC[AGG], in The PAM sequence is in brackets.

[0039] (2) Check whether there is a single nucleotide polymorphism (SNP) at the target site by conventional methods:

[0040] Six zebrafish were randomly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an establishing method for a fish male sterile model. A CRISPR / Cas9 technique is utilized to knock out a meiosis-related gene spo11; heterozygote is fertile; male individuals in a homozygote colony acquired through selfing of heterozygote are sterile, so that the fish male sterile model is established. The sterile male individuals can be specifically acquired according to the method disclosed by the invention; the male sterile individuals can be continuously supplied in the manner of establishing a knockout family; the operation is simple and the time is saved.

Description

technical field [0001] The invention relates to a method for establishing a fish male sterility model, belonging to the field of molecular biology. Background technique [0002] Fish obtain energy from the outside world, part of which is used for growth and part for reproduction. During the reproductive period, growth slows down or even stops, and the reproductive period of many fish is between the growth periods. Because all-male fish grows faster and the individuals are relatively large, they become the object of everyone's competition for breeding. Therefore, in recent years, how to establish male sterile lines in fish has become one of the more popular research directions. Spo11 is a homologous protein of type II topoisomerase, which is involved in the formation of DNA double-strand break complexes (DSBs) and plays an important role in the occurrence of homologous recombination in meiosis. Recombination plays a crucial role in meiosis in most sexually reproducing organi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N9/22A01K67/027
CPCA01K67/0275C12N9/22C12N15/85C12N15/907A01K2267/03A01K2227/40A01K2217/075
Inventor 张运生杨品红刘良国
Owner HUNAN UNIV OF ARTS & SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More