Supercharge Your Innovation With Domain-Expert AI Agents!

Methods of producing a fermentation product in trichoderma

A fermentation product, Trichoderma reesei technology, applied in biochemical equipment and methods, fermentation, enzymes and other directions, can solve problems such as ineffective utilization of sucrose

Inactive Publication Date: 2019-03-01
NOVOZYMES AS
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Trichoderma reesei strains cannot efficiently utilize sucrose as a carbon source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods of producing a fermentation product in trichoderma
  • Methods of producing a fermentation product in trichoderma
  • Methods of producing a fermentation product in trichoderma

Examples

Experimental program
Comparison scheme
Effect test

example

[0073] Materials and Methods

[0074] Growth medium:

[0075] Fermentation medium

[0076]

[0077] Seed medium NNCell1:

[0078]

[0079]

[0080] SOC medium

[0081] 20g / liter tryptone

[0082] 5g / L yeast extract

[0083] 4.8g / L MgSO 4

[0084] 3.603g / L dextrose

[0085] 0.5g / L NaCl

[0086] 0.186g / L KCl

[0087] 2XYT board

[0088] 16g / liter tryptone

[0089] 10g / L yeast extract

[0090] 5g / L NaCl

[0091] 15g / liter agar

[0092] COVE board

[0093] 342.3g sucrose

[0094] 20ml Cove's saline solution

[0095] 10ml 1M acetamide

[0096] 10ml 1.5M CsCl

[0097] 25g agar (Noble)

[0098] water to 1 liter

[0099] COVE saline solution

[0100] 26g KCl

[0101] 26g MgSO 4 7H 2 o

[0102] 76g KH 2 PO 4

[0103] 50ml COVE Trace Elements

[0104] water to 1 liter

[0105] COVE trace elements

[0106] 0.04g Nz 2 B 4 o 7 10H 2 o

[0107] 0.4g CuSO 4 5H 2 o

[0108] 1.2g FeSO 4 7H 2 o

[0109] 0.7g MnSO 4 h 2 o

[0...

example 1

[0133] Example 1 clone and prepare the plasmid encoding Aspergillus niger suc1 gene

[0134] The expression vector pMJ09 (WO 2005 / 067531) was used as the basis of the expression vector of this example.

[0135] The A. niger suc1 gene encoding invertase was PCR amplified from genomic DNA prepared from A. niger ATCC 1015 using the PCR primers shown below:

[0136] Suc1 F vector flk attacgaattgtttaaacgt gctttacttcactcgtgcatgggg (SEQ ID NO:2)

[0137] Suc1 R vector flk aaatggattgattgtct caccacgtgcacattcatattccgc (SEQ ID NO:3)

[0138] The underlined bases correspond to the gene sequence of Suc1, while the ununderlined bases correspond to the vector sequence.

[0139] reaction mixture

[0140]

[0141] PCR conditions:

[0142] Step 1 98°C for 30 seconds

[0143] Step 2 98°C for 10 seconds

[0144] Step 3 56°C for 15 seconds

[0145] Step 4 72°C for 160 seconds

[0146] Steps 2-4 were repeated for 34 cycles, and then the reaction mixture was kept at 10 °C.

[0147]...

example 2

[0152] Example 2 Transformation of Trichoderma reesei with pVCK12TRI001 comprising Aspergillus niger suc1 gene

[0153] Plasmid pVCK12TRI001 was linearized with the restriction endonuclease PmeI and transformed into Trichoderma reesei RutC30 strain essentially as described in Example 6 of WO 2008 / 151079, and the transformation was plated onto COVE plates.

[0154] Twenty one transformants were selected and transferred to plates of COVE2 + 10 mM uridine and incubated at 28°C for 22-26 days.

[0155] Transformants were subcultured onto new COVE2 plates, Trichoderma minimal plates + 2% sucrose and Trichoderma minimal plates + 2% glucose and incubated at 28°C for 8 days. All transformants grew well on Trichoderma minimal plates + 2% sucrose, Trichoderma minimal plates + 2% glucose and COVE2 plates. The untransformed Trichoderma reesei RutC30 strain did not grow on Trichoderma minimal plates + 2% sucrose, but grew as expected on Trichoderma minimal plates + 2% glucose.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This application discloses methods for fermenting recombinant Trichoderma reesei comprising a heterologous invertase gene, using sucrose as carbon source.

Description

[0001] References to Sequence Listings [0002] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. technical field [0003] The present invention relates to a method for producing a fermentation product in Trichoderma reesei cells in a fermentation medium comprising sucrose. The fermentation product may be a protein product, such as an enzyme product. Background technique [0004] Trichoderma reesei is a well-known filamentous fungus which in recent years has been frequently used in fermentation processes, for example for the production of protein products, especially for the production of enzymes. [0005] Trichoderma reesei is known to produce a wide variety of cellulases and hemicellulases, and this organism is often used to produce enzyme products including cellulases and / or hemicellulases. However, the use of T. reesei is not limited to the production of cellulases and hemicellulases, but also includes th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P21/02C12N15/66C12N9/24
CPCC12P21/02C12Y302/01021C12Y302/01026C12N9/24C12N9/12C12N9/2402C12N15/52C12N15/66
Inventor A·詹格S·梅里诺K·汉森G·蒙克沃德B·普洛赫
Owner NOVOZYMES AS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com