Primer group, kit and method for detecting polymorphic sites of psychotropic drug related genes
A technology for gene polymorphism and primer detection, applied in biochemical equipment and methods, microbial determination/inspection, recombinant DNA technology, etc., can solve the problems of detection failure, high failure rate, and complicated result interpretation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] The kit for detecting polymorphic sites associated with psychotropic drugs provided in this embodiment includes a primer set for detecting polymorphic sites associated with psychotropic drugs, and the primer set includes the following primer combination 1-primer combination 25.
[0090] Wherein, primer combination 1 includes: amplification primers shown in SEQ ID NO.1-2 and detection primers shown in SEQ ID NO.51;
[0091] Primer combination 2 includes: amplification primers shown in SEQ ID NO.3-4 and detection primers shown in SEQ ID NO.52;
[0092] Primer combination 3 includes: amplification primers shown in SEQ ID NO.5-6 and detection primers shown in SEQ ID NO.53;
[0093] Primer combination 4 includes: amplification primers shown in SEQ ID NO.7-8 and detection primers shown in SEQ ID NO.54;
[0094] Primer combination 5 includes: amplification primers shown in SEQ ID NO.9-10 and detection primers shown in SEQ ID NO.55;
[0095] Primer combination 6 includes: am...
Embodiment 2
[0139] Using the kit and method of Example 1, 20 samples (all from clinics, the sample type being whole blood or buccal swab) with known SNP locus genotypes were tested, and the results are shown in Table 5-7 below.
[0140] table 5
[0141]
[0142]
[0143] Table 6
[0144]
[0145] Table 7
[0146]
[0147] Among them, the mass spectrometry results of sample No. 1 are shown in figure 1 . The known results in Table 5-7 are statistics of sample results detected by traditional methods (fragment analysis, single base extension and sanger sequencing), and the detection results on the right are the results detected by the primer set in Example 1. The results show that the results using the primer set and detection method of Example 1 are consistent with the results of the traditional method.
experiment example 1
[0149] There is one SNP site rs1024814428 with a high mutation rate within 3 bases of rs12248560, 2 SNPs within 10 bases, and 7 SNPs within 20 bases of rs4986893 between. In addition, there are pseudogenes in the genome, and it is very easy to amplify non-target fragments, so the general strategy in primer design is to amplify as long as possible fragments, and then detect, which will easily result in fewer single detection sites and low throughput (such as Sequencing analysis, fragment analysis); if the amplification length is reduced, the detection will easily fail. These reasons indicate that the design of various primers in the primer set of the present invention requires creative work.
[0150] Based on this, for the rs12248560 site, design a control primer pair 1:
[0151] F (on behalf of the upstream primer, the same below): CGTGGCGCATTATCTCTTAC;
[0152] R (represents the downstream primer, the same below): AACAAAGTTTTTAGCAAACG.
[0153] The amplified product 86bp ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


