Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer group, kit and method for detecting polymorphic sites of psychotropic drug related genes

A technology for gene polymorphism and primer detection, applied in biochemical equipment and methods, microbial determination/inspection, recombinant DNA technology, etc., can solve the problems of detection failure, high failure rate, and complicated result interpretation.

Inactive Publication Date: 2019-03-15
GUANGZHOU KINGMED DIAGNOSTICS CENT
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The original results obtained by traditional detection methods cannot be directly displayed on the instrument, and the experimenter needs to set the parameter analysis by himself, and the result interpretation is complicated
Traditional detection methods require the use of fluorescently labeled primers or ddNTPs or long-segment primers. Exposure to room temperature or light for a long time, or repeated freezing and thawing times can easily lead to detection failure, with a high failure rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, kit and method for detecting polymorphic sites of psychotropic drug related genes
  • Primer group, kit and method for detecting polymorphic sites of psychotropic drug related genes
  • Primer group, kit and method for detecting polymorphic sites of psychotropic drug related genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] The kit for detecting polymorphic sites associated with psychotropic drugs provided in this embodiment includes a primer set for detecting polymorphic sites associated with psychotropic drugs, and the primer set includes the following primer combination 1-primer combination 25.

[0090] Wherein, primer combination 1 includes: amplification primers shown in SEQ ID NO.1-2 and detection primers shown in SEQ ID NO.51;

[0091] Primer combination 2 includes: amplification primers shown in SEQ ID NO.3-4 and detection primers shown in SEQ ID NO.52;

[0092] Primer combination 3 includes: amplification primers shown in SEQ ID NO.5-6 and detection primers shown in SEQ ID NO.53;

[0093] Primer combination 4 includes: amplification primers shown in SEQ ID NO.7-8 and detection primers shown in SEQ ID NO.54;

[0094] Primer combination 5 includes: amplification primers shown in SEQ ID NO.9-10 and detection primers shown in SEQ ID NO.55;

[0095] Primer combination 6 includes: am...

Embodiment 2

[0139] Using the kit and method of Example 1, 20 samples (all from clinics, the sample type being whole blood or buccal swab) with known SNP locus genotypes were tested, and the results are shown in Table 5-7 below.

[0140] table 5

[0141]

[0142]

[0143] Table 6

[0144]

[0145] Table 7

[0146]

[0147] Among them, the mass spectrometry results of sample No. 1 are shown in figure 1 . The known results in Table 5-7 are statistics of sample results detected by traditional methods (fragment analysis, single base extension and sanger sequencing), and the detection results on the right are the results detected by the primer set in Example 1. The results show that the results using the primer set and detection method of Example 1 are consistent with the results of the traditional method.

experiment example 1

[0149] There is one SNP site rs1024814428 with a high mutation rate within 3 bases of rs12248560, 2 SNPs within 10 bases, and 7 SNPs within 20 bases of rs4986893 between. In addition, there are pseudogenes in the genome, and it is very easy to amplify non-target fragments, so the general strategy in primer design is to amplify as long as possible fragments, and then detect, which will easily result in fewer single detection sites and low throughput (such as Sequencing analysis, fragment analysis); if the amplification length is reduced, the detection will easily fail. These reasons indicate that the design of various primers in the primer set of the present invention requires creative work.

[0150] Based on this, for the rs12248560 site, design a control primer pair 1:

[0151] F (on behalf of the upstream primer, the same below): CGTGGCGCATTATCTCTTAC;

[0152] R (represents the downstream primer, the same below): AACAAAGTTTTTAGCAAACG.

[0153] The amplified product 86bp ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group, a kit and a method for detecting polymorphic sites of psychotropic drug related genes and relates to the technical field of gene polymorphism detection. The primer group comprises one or more of combinations 1-25. The primer group can be used for detecting the polymorphism of 25 SNP sites of 20 psychotropic drug related genes simultaneously and has the characteristics that the cost is low, result interpretation is simple, interference among SNP sites is avoided and the like.

Description

technical field [0001] The invention relates to the technical field of gene polymorphism detection, in particular to a primer set, a kit and a method for detection of psychotropic drug-related gene polymorphism sites. Background technique [0002] Mental illness has become a high-incidence disease in my country, and drug treatment is the main clinical method for mental illness at present, but there are also obvious individual differences in drug efficacy and adverse reactions. The reason for the difference, in addition to pathology, physiology, gender, age, height, weight, compliance, etc., genetic factors are important factors affecting the difference in drug response. [0003] Studies have found that the efficacy of drugs used to treat mental illness is associated with multiple genotypes, and that there are significant differences in the therapeutic effects of drugs with different genotypes. In recent years, pharmacogenomics has developed rapidly. In the drug instructions...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/106C12Q2600/156
Inventor 汤愿笑赵薇薇严慧朱阳进胡昌明徐艳艳甘立佳于世辉
Owner GUANGZHOU KINGMED DIAGNOSTICS CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More