Unlock instant, AI-driven research and patent intelligence for your innovation.
New method for gene point mutation repair
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A point mutation and new method technology, applied in the field of gene repair, can solve the problems of incomplete meiosis of germ cells, Msh5 can not run normally, germ cell death and other problems
Inactive Publication Date: 2019-03-29
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 4 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0004] Our previous research found a genetic mutation that can lead to primary amenorrhea in women (TING GUO ETAL, 2017, HUMAN MOLECMLAR GENETICS), which is located at the G to C mutation at position 1459 of the Msh5 gene, which leads to the inability of Msh5 Normal driving function, so that the germ cellmeiosis process cannot be completed, and eventually cause germ cell death
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0036] Embodiment 1 The construction of vector
[0037] 1. Design of sgRNA: Use the sgRNA online design tool to select a suitable sgRNA near the mutation site.
[0038] sgRNA selects Guide#1 and Guide#8, and the sequence information is:
[0039] Guide #1 CTATCGTAGCGCCCGGACCAAGG
[0040] Guide #8 CAAGGAGCTGTACACGCTGCTGG.
[0041] 2. Construct the sgRNA onto the pCS (eGFP) vector, which carries the Cas9 protein.
[0042] (1) Design primers: introduce restriction site BbsI into the upstream and downstream primers, and the primer sequences are:
[0043] Guide #1: F-CACCGCTATCGTAGCGCCCGGACCA
[0044] R-AAACTGGTCCGGGCGCTACGATAGC
[0045] Guide #8: F-CACCGCAAGGAGCTGTACACGCTGC
[0046] R-AAACGCAGCGTGTACAGCTCCTTGC
[0047] (2) Primers anneal into double strands: primers are annealed after being dissolved in TE to 200 μM
[0048] Annealing system total 20μL
[0049]
[0050] After mixing, put it directly into boiling water and anneal until it cools to room temperature, and p...
Embodiment 2
[0061] Example 2 Detection of Cutting Efficiency of Vector
[0063] The constructed vector was extracted with an endotoxin-free plasmid extraction kit.
[0064] 1. Pronuclear injection of fertilized eggs, identification of blastocysts, and verification of cleavage activity
[0065] The carrier is injected into the pronuclear fertilized egg, and the fertilized egg is developed to the blastocyst stage (about 4 days), and the blastocyst is identified to detect whether the cutting is correct. Blastocysts were lysed overnight in a water bath at 56°C by adding 99 μL of lysis solution and 1 μL of proteinase K. The cleaved product was treated at 95°C for 5 minutes to denature proteinase K, and the product could be used for PCR. Blastocyst identification uses Extag for PCR amplification, and the PCR products of the target bands are sent for sequencing.
[0066] Extag PCR system 50μL
[0067]
[0068] Extag PCR reaction program
[...
Embodiment 3
[0098] Example 3 Design Doner DNA
[0099] Select a correct sequence near the upstream and downstream of the mutation site as Donor, and send it to Synthetic. The sequence is:
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The present invention provides a new method for genepoint mutation repair. Main steps are as follows: in a target genome sequence, cellgenemutation sites are selected as repaired gene sites; according to the selected gene repair sites, sgRNA of a CRISPR / Cas 9 system is designed; the sgRNA is constructed to an expression vector carrying CRISPR / Cas9 proteins; a segment of correct sequence is selected near upstream or downstream of the mutation sites, and a designed Donor DNA is used as a template for the gene mutation repair; in vitro culture of cells carrying the mutation site genes is conducted; an electrotransfection method is used to transfect the sgRNA, CRISPR / Cas9 expression vector and Donor DNA into the cells. The method fully mixes a Cas9 expression vector, the sgRNA and the DonorDNA with mouse fibroblastcell line carrying Msh5 point mutation established in vitro, then the cell line is electrically transfected to increase transfection efficiency of the cells, and the CRISPR / Cas9 system is used to conduct the repair of the mutation sites, thereby providing a scientific basis for treatment of primary amenorrhea in women.
Description
technical field [0001] The invention belongs to the technical field of gene repair, in particular to a new method for gene point mutation repair. Background technique [0002] CRISPR / CAS9 system is a new high-efficiency gene editing technology developed in recent years, which can delete and modify the genome at the cellular level. Since the CRISPR / CAS system was announced in early 2013, it has been widely used all over the world, and was named one of the top ten scientific breakthroughs in 2015 by the "SCIENCE" magazine. CRISPR / CAS9 is an RNA-protein complex. The commonly used CAS9 nuclease is composed of 1409 amino acids and has two important nuclease domains, namely RUVC and HNH domains. The HNH domain is responsible for cleavage by targeting complementary DNA single strands, and the cleavage site is located 3NT upstream of the PAM (PROTOSPACER-ADJACENT MOTIFS) sequence. The RUVC domain is responsible for breaking the other DNA strand, and the cutting site is located 3-8...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More