Unlock instant, AI-driven research and patent intelligence for your innovation.

A subunit vaccine based on prokaryotic expression of norovirus epitope and preparation method thereof

A subunit vaccine and virus antigen technology, applied in the field of biomedicine, can solve the problems that are not suitable for large-scale vaccine research and development, production requirements, intestinal-like tissue is difficult to establish and maintain, and achieve good immunogenicity advantages and high sensitivity , strong specific effect

Active Publication Date: 2022-06-03
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The in vitro culture of Norovirus has always been an important factor restricting Norovirus vaccines. At the same time, the lack of suitable animal models is also the key to restricting the development of traditional vaccines. Although the latest research shows that intestinal-like tissues derived from human small intestinal stem cells can Norovirus can be cultivated in vitro, but intestinal-like tissues are difficult to establish and maintain, and are not suitable for traditional large-scale vaccine development and production. Therefore, genetic engineering vaccines have become the best choice for norovirus vaccine development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A subunit vaccine based on prokaryotic expression of norovirus epitope and preparation method thereof
  • A subunit vaccine based on prokaryotic expression of norovirus epitope and preparation method thereof
  • A subunit vaccine based on prokaryotic expression of norovirus epitope and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] 1 material

[0024] 1.1 Norovirus recombinant antigen sequence design

[0025] Source: NCBI Reference Sequence: NC_029646.1

[0026] Neutralizing epitope of human norovirus type GII: 105bp.

[0027] The specific sequence is as follows:

[0028] GGATCCAACCACGTGTGGAACATGCAGGTT GGTGGCGGTGGCAGC GCGAAGTTCACCCCGAAACTGGGTGCGATCCAAATTGGCACCTGGGAGGAAGACGAATTC The underlined part is the linking peptide

[0029] 1.2 Enzymes

[0030] name Remark BamHI Purchased from NEB Corporation EcoRI Purchased from NEB Corporation T4 ligase Purchased from NEB Corporation

[0031] 1.3 Carrier

[0032]

[0033] 1.4 Reagents and kits

[0034]

[0035]

[0036] 1.5 Instruments

[0037] name Remark shaker Purchased from Beijing Liuyi Instrument Factory, model WD-9405B Electrophoresis Purchased from BIO-RAD, USA, model 200 / 2.0Power Supply Sonicator Purchased from Ningbo Xinzhi Co., Ltd., model JY 92-IIN Water...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
antibody titeraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biomedicine, in particular to a preparation method based on prokaryotic expression of norovirus epitope subunit vaccines. The present invention provides a prokaryotic expressed subunit vaccine for stimulating the body to produce specific antibodies against Norovirus, characterized in that the Norovirus recombinant antigen sequence is SEQ ID NO: 1, source: NCBI Reference Sequence: NC_029646 .1. The neutralizing epitope of human norovirus type GII: 105bp, the expression vector is: the modified hepatitis B core antigen (HBcAg) gene is cloned into the pThioHisA expression vector.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a preparation method of a vaccine based on prokaryotic expression of norovirus antigenic epitope subunits. Background technique [0002] Norovirus (NoV) is the main pathogen of acute gastroenteritis in humans. Because of the obvious seasonality of gastroenteritis caused by it, it was called "winter vomiting disease" in 1929. The complexity of norovirus genotypes and the rapid variation among norovirus types make the development of norovirus vaccines slow. So far, there is no stable and effective vaccine for large-scale vaccination, and no safe and stable anti-virus vaccine. Venomous serum is used for emergency protection of high-risk exposed populations. [0003] Norovirus belongs to the genus Norwalk virus in the family Calicivirus, and its viral RNA contains three open reading frames (ORFs). Noroviruses can be divided into seven groups according to their RNA polymerase and capsid p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/12C07K14/08C07K1/36C07K1/30C07K1/18A61P31/14
CPCA61K39/12A61P31/14C07K14/005C12N2770/10051C12N2770/16034C12N2770/16022Y02A50/30
Inventor 李鸿钧刘洋林晓晨周艳吴晋元解裕萍
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI