Primer set and application thereof
A primer set and primer combination technology, applied in the biological field, can solve the problems of high experimental operation requirements and long detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0234] Example 1 Preparation of Primer Group I, Primer Group II, Primer Group III, Primer Group IV and Primer Group V
[0235] The kit consists of four LAMP primer sets, one for each species of Candida.
[0236] The primer set for detecting Rhizopus oryzae is as follows (5'→3'):
[0237] Outer primer F3 (SEQ ID No.1): GGTAGCAAATCCAGTC;
[0238] Outer primer B3 (SEQ ID No.2): CCTCCCAAGCGATC;
[0239] Internal primer FIP (SEQ ID No.3):
[0240] ACGGGTCGTGTCAAGGTTCTGGACTGCCTCCAA;
[0241] Internal primer BIP (SEQ ID No.4):
[0242] CGTCCATCTTGGCGATGTTGGGAATCCCCATGTTCA;
[0243] Loop primer LF (SEQ ID No.5): CCGGAGCCAATGACCT;
[0244] Loop primer LB (SEQ ID No. 6): CTCAATCGGTCCATGC.
[0245] The primer set used to detect Mucorella umbelliferus is as follows (5'→3'):
[0246] Outer primer F3 (SEQ ID No.7): GGGTAAAAAAGGTGGATG;
[0247] Outer primer B3 (SEQ ID No.8): CATTGGATCCCTTTTTC;
[0248] Internal primer FIP (SEQ ID No.9):
[0249] CCAAGAGGTGAGGTTGGGATGTTGCCTCTTCAGCT...
Embodiment 2
[0278] The specificity of embodiment 2 mucormycetes primer combinations
[0279] 1. Preparation of samples to be tested
[0280] Test sample 1: Rhizopus oryzae plasmid
[0281] Test sample 2: Mucorella umbelliferum plasmid
[0282] Test sample 3: Plasmid of Mucor circiniferans
[0283] Sample to be tested 4: Rhizomucor micromus plasmid
[0284] Rhizopus oryzae detection gene plasmid: Insert the DNA molecule with Genebank number AB167714.1 between the MCS of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is rice root Mold detection gene plasmid.
[0285] Mucorella umbellatus detection gene plasmid: Insert a DNA molecule with a Genebank number of GQ342716.1 between the MCSs of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is the umbrella Mucoral spp. detection gene plasmid.
[0286] Mucor crimperida detection gene plasmid: Insert a DNA molecule with Ge...
Embodiment 3
[0299] Example 3 Mucorales fungi identify the sensitivity of the primer combination
[0300] Sample 1 to be tested: the Rhizopus oryzae gene plasmid DNA to be tested in Example 2.
[0301] Sample 2 to be tested: the gene plasmid DNA of Mucor umbelliferum to be tested in Example 2.
[0302] Test sample 3: the test gene plasmid DNA of Mucor circiniferans of Example 2.
[0303] Sample 4 to be tested: the Rhizomucor pumilii test gene plasmid DNA of Example 2.
[0304] 1. The plasmid DNA of the gene to be tested is serially diluted with sterile water to obtain each dilution.
[0305] 2. Using the dilution obtained in step 1 as a template, respectively use the primer set I, primer set II, primer set III or primer set IV prepared in Example 1 to perform loop-mediated isothermal amplification.
[0306] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the sample to be tested is the sample to be...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



