Method, primers, probe and detection agent for tumor gene mutation detection

A mutation detection and tumor gene technology, applied in the field of molecular biology, can solve the problems of time-consuming, inability to detect and distinguish T790M/C797S cis and trans mutations, and high cost, so as to avoid human misjudgment

Pending Publication Date: 2019-05-17
SHANGHAI TONGSHU BIOLOGY SCI & TECH CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the ARMS-PCR method used clinically cannot detect and distinguish the cis and trans mutations of T790M / C797S, so NGS sequencing methods can only be used to distinguish cis or trans mutations, which is time-consuming and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, primers, probe and detection agent for tumor gene mutation detection
  • Method, primers, probe and detection agent for tumor gene mutation detection
  • Method, primers, probe and detection agent for tumor gene mutation detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Detection is performed on the V600E mutation site of the BRAF gene, and the sample in Example 1 is a point mutation. The primer sequences used are as follows:

[0056]primer-F1: CTTCATGAAGACCTCACAGTAAAAATAGG

[0057] primer-R1: ACAAAATGGATCCAGACAACTGTTC

[0058] The probe sequences employed are as follows:

[0059] primer-P1: FAM-TCTAG GA ACAGAGAA CC - MGB.

[0060] The detection steps are as follows:

[0061] (1) Extraction of DNA / RNA from positive and wild-type tissue samples: AllPrep DNA / RNA / miRNA Universal Kit (QIAGEN Cat. No. 80224) was used for extraction, and the specific extraction steps were operated according to the kit instructions. The extracted DNA was diluted to 5ng / μL, and the RNA was diluted to 10ng / μL.

[0062] (2) The wild-type sample that has been determined to have no mutation is used as a negative control.

[0063] (3) Prepare PCR reaction solution according to the DNA PCR reaction system of Table 1 and the RNA PCR reaction system of Table...

Embodiment 2

[0082] The V769_D770insASV mutation site of the EGFR gene was detected. The sample mutation type in Example 2 is repetitive insertion of short segments. The primer sequences used are as follows:

[0083] primer-F2: GCCACACTGACGTGCCTCTC

[0084] primer-R2: GTCCAGGAGGCAGCCGAAGG

[0085] The probe sequences employed are as follows:

[0086] primer-P2: FAM-CCAGCG ACAG CAGCGTG-BHQ.

[0087] The detection steps refer to Example 1. The test results of the samples in Example 2 are consistent with the results of the first-generation sequencing.

[0088] The detection sensitivity of embodiment 2 can reach 2.0% (see Figure 8 ).

Embodiment 3

[0090] Detection of the A775_G776insYVMA mutation site of the HER2 gene. The sample mutation type in Example 3 is repetitive insertion of short segments. The primer sequences used are as follows:

[0091] primer-F3: CGTGATGGC ATACGTGATGGC

[0092] primer-R3: CCAGCTGCACCGTGGATGTCAG

[0093] The probe sequences employed are as follows:

[0094] primer-P3: FAM-C TC TATGTCTCCCGCCTTCTG-BHQ.

[0095] The detection steps refer to Example 1. The test results of the samples in Example 3 are consistent with the results of the first-generation sequencing.

[0096] The detection sensitivity of embodiment 3 can reach 0.8% (see Figure 9 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primers, a probe and a detection agent for tumor gene mutation detection. The method includes the following steps that 1, a pair of target sequence specific amplification primers for amplifying nuclei acid fragments containing mutant bases are designed; 2, the DNA probe capable of being matched with the mutant bases is designed and contains modification groups capable of fluorescing during nuclei acid fragment amplification; 3, cervical-loop structures are introduced in optional positions of the primers and / or the DNA probe and are composed of 2-12 nucleotideswhich are not matched with the nuclei acid fragments, and when the primers and / or the DNA probe are combined with the nuclei acid fragments, the cervical-loop structures protrude to be in an annularor single-chain state; 4, the primers and the nuclei acid fragments are adopted to conduct PCR amplification, and fluorescence data is collected through the DNA probe. By adopting the method, a wide range of mutations can be detected, and the sensitivity is high.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, in particular to a method, primer, probe and detection agent for detecting tumor gene variation. Background technique [0002] Tumor is a disease with high morbidity and mortality, which seriously endangers public health. In recent years, clinicians have discovered in tumor treatment that human tumors vary greatly, and even for tumors in the same part, the treatment effects and methods should vary from person to person. Therefore, in the process of cancer treatment, only when the same disease is treated differently, and individualized treatment is implemented, can the appropriate drugs be selected for different types of patients. [0003] With the deepening of research at the molecular level of genes, more and more tumor cell signaling pathways have been discovered. A large number of clinical studies have shown that the mutation / amplification / expression sta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
CPCY02A50/30
Inventor蔡微菁严令华
OwnerSHANGHAI TONGSHU BIOLOGY SCI & TECH CO LTD