Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for establishing urine microRNA target gene database ratio model for diagnosing bladder cancer

A model building and database technology, applied in the medical field, can solve problems such as easy missed detection of bladder cancer, achieve high clinical reference value, simplify the diagnosis process, and improve the diagnosis accuracy.

Inactive Publication Date: 2019-06-14
GENERAL HOSPITAL OF NINGXIA MEDICAL UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Urine cytology is also widely used as a non-invasive marker technique, but it is easy to miss low-grade bladder cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing urine microRNA target gene database ratio model for diagnosing bladder cancer
  • Method for establishing urine microRNA target gene database ratio model for diagnosing bladder cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] The specific embodiment of the present invention is as follows: the urinary microRNA target gene database ratio model establishment method that is used for bladder cancer diagnosis, the establishment method step of this ratio model is as follows:

[0037] (1) Collection of model data information: collecting relevant information of has-miR-182-5p and has-miR-152-3p in the miRBase database;

[0038] Table 1 Sequence information and primers of has-miR-182-5p and has-miR-152-3p

[0039] Gene

Accession number

Mature body sequence information (5'→3')

Upstream primer sequence (5'→3')

has-miR-182-5p

MIMAT0000259

UUUGGCAAUGGUAGAACUCACACU

TTTGGCAATGGTAGAACTCACACT

has-miR-152-3p

MIMAT0000438

UCAGUGCAUGACAGAACUUGG

TCAGTGCATGACAGAACTTGG

[0040] (2) Collection and storage of urine specimens: samples are collected in 15ml sterile enzyme-free centrifuge tubes, collect 7ml of fresh urine in the morning, add 3.54g of guanid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for establishing a urine microRNA target gene database ratio model for diagnosing a bladder cancer comprises the following steps: collecting model data information; collecting and storing a urine sample; preparing total RNA in the sample; synthesizing a first chain cDNA sequence; executing fluorescent quantitative PCR detection, wherein the ratio (Ct 182-5p / Ct 152-3p) of miRNA detection results Ct serves as a diagnostic indicator. The urine microRNA ratio model for early screening of the bladder cancer and a kit can provide a more reliable judgment basis for early screening of the bladder cancer, and objective indexes of the ratio models of miR-182-5p and miR-152-3p is comprehensively evaluated with other early tumor screening markers, so that the diagnosis accuracy is improved, the diagnosis process is simplified, and the ratio model plays an important role in the diagnosis and treatment of the bladder cancer.

Description

technical field [0001] The invention relates to the technical field of medicine, in particular to a method for establishing a ratio model of a urine microRNA target gene database for bladder cancer diagnosis. Background technique [0002] Bladder cancer is one of the most common cancers in the world with low survival rate and frequent distant metastasis. Typically, the diagnosis of bladder cancer requires invasive cystoscopy and biopsy, often with adverse effects and inconvenience. The sensitivity of current methods used clinically to diagnose bladder cancer ranges from 57-82% to 74-88%, with sensitivity increasing with the stage and extent of the cancer. Urine cytology is also widely used as a noninvasive marker technique, but it is easy to miss low-grade bladder cancer. With the further elucidation of tumorigenesis, progression, and treatment-related mechanisms at the molecular level, it is urgent to develop new diagnostic methods for the initial diagnosis and monitoring...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851
Inventor 董辉李明明
Owner GENERAL HOSPITAL OF NINGXIA MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com