Method for methylating EGCG through enzymatic catalysis

An enzymatic catalysis and methylation technology, applied in microorganism-based methods, biochemical equipment and methods, enzymes, etc., can solve the problems of low enzyme catalysis efficiency, difficult to meet the needs of actual production, etc., and achieve efficient methylation. Effect

Inactive Publication Date: 2019-08-09
COFCO NUTRITION & HEALTH RES INST +2
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the catalytic efficiency is affected by many factors, and the existing enzymes have low catalytic efficiency, which is difficult to meet the needs of actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for methylating EGCG through enzymatic catalysis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Construction of recombinant escherichia coli

[0032] Using a high-efficiency plant genomic DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), the genome was extracted from commercially available Benifuuki tea leaves according to the manufacturer's instructions, and then, the genome was extracted using a method purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. TIANSeq high-fidelity PCR reaction master mix, according to the manufacturer's instructions with primers F and R (F: CATATGGCGACCAACGGTGAA (SEQ ID NO.: 1); R: CTCGAGGCAAACACG (SEQ ID NO.: 2)) for PCR cloning (PCR program Pre-denaturation at 94°C for 5 minutes; 94°C for 30s, 50°C for 50s, 72°C for 1min, 35 cycles; 72°C for 10min), use 1.0% agarose gel electrophoresis to detect PCR amplification products, PCR amplification products according to the purchased The nucleic acid sequence encoding O-methyltransferase (SEQ ID NO.: 3; referred to as "O-meth...

Embodiment 2

[0034]Example 2: Cultivation of recombinant Escherichia coli and expression of O-methyltransferase

[0035] A single colony of the positive recombinant bacteria obtained in Example 1 was picked and inoculated into fresh LB medium, and cultured at 37° C. for 8 hours as a seed solution.

[0036] The above-mentioned seed liquid is inoculated into the fermentation medium according to the inoculum size of 5% (v / v) (glucose 20g / L, yeast extract powder 5g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate 0.2g / L, manganese sulfate 0.2g / L, and the remaining amount of water), through exponential feeding of glucose and yeast powder, the fermentation process of recombinant Escherichia coli is controlled, and the dissolved oxygen concentration is kept at 20%-30%. Grow to OD 600 At 60, the expression of O-methyltransferase was induced by adding 10% (w / v) lactose at a constant flow rate of 0.04 mL / min; the fermentation temperature was 30°C. Samples were taken at different time poin...

Embodiment 3

[0037] The preparation of embodiment 3 crude enzyme liquid

[0038] The fermentation broth obtained in Example 2 was centrifuged at 12000rpm for 10min, and the thalline was collected, and an equal volume of 20mM PBS buffer (20mmol / L NaH 2 PO 3 , 20mmol / L Na 2 HPO 3 , 1mmol / L DTT, pH 7.4) to resuspend the bacteria (dilute according to the concentration of the bacteria to make the OD 600 10), sonicated (sonicated for 2 s, intermittently for 2 s, 5 min in total), and centrifuged at 12000 rpm for 10 min to collect the supernatant to obtain a crude enzyme solution.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for methylating EGCG through enzymatic catalysis. A crude enzyme solution is prepared from a culture of recombinant escherichia coli integrated with an O-methyltransferase gene from Benifuuki tea, and an enzymatic catalytic reaction is carried out under specific conditions, and then the effect of efficiently methylating EGCG is achieved.

Description

technical field [0001] The invention relates to a method for improving enzymatic catalysis efficiency, in particular to a method for enzymatically catalyzing EGCG methylation with high efficiency. Background technique [0002] Epigallocatechin gallate (EGCG) is the main polyphenolic substance in green tea. Among them, ester-type catechin is the main component of the bitterness and astringency of tea. The outstanding antioxidant properties of EGCG have attracted widespread attention at home and abroad. focus on. Preclinical evidence from McMaster University in Canada suggests that EGCG interferes with the formation of toxic oligomers, one of the early suspects of cognitive decline in Alzheimer's patients. However, EGCG is unstable at room temperature and is difficult to deliver to the human body, especially the brain, so modifying EGCG makes it more effective as a food additive. Methylated catechins (EGCG3"Me and EGCG4"Me) have good anti-allergic effects, and oral administr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P17/06C12N9/10C12R1/19
CPCC12N9/1007C12P17/06
Inventor杨鑫安泰朱威宇陈博陈志雄涂丛慧卢秋华焦琳郑晓卫金渭武
OwnerCOFCO NUTRITION & HEALTH RES INST