Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Two gRNA sequences capable of targeting two genes xa13 and xa25 at same time and efficiently creating bacterial-blight-resistant rice

A technology targeting genes and bacterial blight, applied in the field of genetic genetics and breeding, can solve the problems of lack of research reports and achieve low cost, high efficiency, and broad spectrum resistance

Active Publication Date: 2019-08-16
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of crop resistance, the earliest report is to use TALEN genome editing technology to target the Os11N3 gene to create resistant materials, and broad-spectrum resistant materials are generally obtained through multiple gRNA-mediated multi-gene editing. no research report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two gRNA sequences capable of targeting two genes xa13 and xa25 at same time and efficiently creating bacterial-blight-resistant rice
  • Two gRNA sequences capable of targeting two genes xa13 and xa25 at same time and efficiently creating bacterial-blight-resistant rice
  • Two gRNA sequences capable of targeting two genes xa13 and xa25 at same time and efficiently creating bacterial-blight-resistant rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: gRNA2-mediated improvement of Yuxiang Youzhan to create a new improved material with broad spectrum and high resistance to bacterial blight

[0029] (A) Sequence analysis of rice xa13 and xa25 genes and construction of targeting vectors

[0030] Use gene-specific primers 13-f: TTAATAACCTTCATCACCAGTAGC / 13-r: CTGTCGTCGTCGAGATCAGT; 25-f: ATTACCCCCCTTTTAGCACA / 25-r: TGCAAGCACGCGTTGACC to amplify rice xa13 and xa25 gene sequences gene sequences such as sequences SEQ ID NO.8, SEQ ID NO .9 shown. Sequence analysis showed that the xa13 gene contained 5 exons, and the xa25 gene contained 6 exons, including a complete expression frame, indicating that the gene functions normally and meets the conditions for further editing. And there is no base difference in the homologous sequence 5'-TCGGTGCCGTACGTGGTGGAGC-3' of the above two genes, so we chose the gRNA2 provided above to construct it into the cas9 expression vector, and the vector used was the artificially synthe...

Embodiment 2

[0042] Example 2: gRNA2-mediated improvement of five-spice silk seedlings to create new improved materials with broad-spectrum and high resistance to bacterial blight

[0043] Target gRNA2 to create a new improved material with broad-spectrum and high resistance to bacterial blight of spiced silk seedlings. The operation method and detection method are the same as in Example 1. The gene sequence of the gene sequence is obtained by amplifying and detecting the xa13 and xa25 target genes of the wild-type material of spiced silk seedlings As shown in the sequences SEQ ID NO.8 and SEQ ID NO.9, the expression frame is complete and the function is normal, which can be used as the editing target material. The operation method is the same as in Example 1. We obtained 33 positive plants from the five-spice silk seedling material, of which 27 clones had the mutation of the target gene, and the other 16 were double-gene mutations of xa13 and xa25, and the double mutation rate reached abou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a base sequence 5'-TCGGTGCCGTACGTGGTGGCGCTCTTCAGC-3' of 30bp in length. The sequence is a long homologous sequence unique to rice bacterial blight infected genes xa13 and xa25,and the sequence is utilized to disclose two gRNAs capable of knocking out xa13 and xa25 infected genes in a targeted manner at the same time. Broad-spectrum rice new materials with double gene mutation and highly resistant to bacterial blight can be screened and obtained by utilizing the gRNAs, an efficient breeding mode is provided for creating broad-spectrum lasting disease-resistant materials, and the sequence is of important significance in studying prevention and control of rice bacterial blight.

Description

technical field [0001] The invention relates to the field of gene genetic breeding, in particular to a method for efficiently creating bacterial blight-resistant rice. Background technique [0002] Rice bacterial blight (Bacterial Blight, BB ) is one of the most harmful bacterial diseases in rice production. It is caused by the gram-negative bacteria Xanthomona soryzae pv. oryzae , Xoo. It usually invades rice from stomata or wounds, spreads along the vascular bundles and spreads to the whole plant, and finally produces off-white lesions on the leaves. The disease affects the photosynthesis of the plants, and the yield decreases by 10%-20% in mild cases, and 30% in severe cases. 50%. In addition, generally planted rice restorer lines contain only a single resistance gene. This makes the resistance spectrum of rice to bacterial blight limited, and it is difficult to cope with the continuous renewal and mutation of bacterial blight. It can be seen that the creation of broad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC12N15/113C12N15/8213C12N15/8281C12N2310/10
Inventor 王锋朱义旺林雅容陈建民周军爱梅法庭陈睿郭新睿
Owner BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com