Cationic lipids for nucleic acid delivery and preparation thereof

A technology of cationic lipids and fatty acid residues, which is applied in the field of cationic lipids for nucleic acid delivery and their preparation, and can solve problems related to nucleic acids and the like

Active Publication Date: 2019-08-23
RAMOT AT TEL AVIV UNIV LTD
View PDF3 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, many problems are associated with nucleic acids in therapeutic settings

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cationic lipids for nucleic acid delivery and preparation thereof
  • Cationic lipids for nucleic acid delivery and preparation thereof
  • Cationic lipids for nucleic acid delivery and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0261] In additional embodiments, the invention relates to cationic lipids comprising a functional group represented by the structure:

[0262] -W-(T=O) m -X-(CH 2 ) z -Y-

[0263] in

[0264] X and Y are each independently O or N, where both X and Y cannot be O;

[0265] W is a bond, O, NH or S;

[0266] T is C or S;

[0267] m is 0 or 1; and

[0268] z is 0 or 2;

[0269] wherein the functional group is attached to at least one saturated or unsaturated fatty acid residue.

[0270] In some embodiments, the cationic lipid comprises two fatty acid residues linked symmetrically or asymmetrically to the functional groups described above.

[0271] In one aspect of the invention, the cationic lipid is represented by the structure of formula (I'):

[0272]

[0273] in

[0274] Y is O or NH;

[0275] T is C or S;

[0276] W is a bond, O, NH or S;

[0277] R 1 Selected from the group consisting of:

[0278] (a) NR 4 R 5 , where R 4 and R 5 each independently is ...

Embodiment 1

[0432] Example 1: Materials and methods:

[0433] Material

[0434] Lipids: All lipids (cholesterol, DSPC and DSPE PEG-maleimide) used for LNP production were purchased from Avanti Polar lipids (USA).

[0435] Monoclonal antibodies: anti-CD45Af647, Annexin-647 were purchased from BioLegend. Propidium iodide was purchased from Sigma-Aldrich.

[0436] siRNA molecules were designed and screened by Alnylam Pharmaceuticals (USA).

[0437] Chemically modified siRNA sequences:

[0438] CD45 siRNA:

[0439] Sense strand: cuGGcuGAAuuucAGAGcAdTsdT (SEQ ID NO: 1)

[0440] Antisense strand: UGCUCUGAAAUUcAGCcAGdTsdT (SEQ ID NO: 2)

[0441] NC5 siRNA (siNC5 or ctl siRNA):

[0442] Sense strand: CAUAUUGCGCGUAUAGUCGCGUUAG

[0443] Antisense strand: UGGUAUAACGCGCAUAUCAGCGCAAUC

[0444] Luc siRNA (siLuc):

[0445] Sense strand: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 3)

[0446] Antisense strand: UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO: 4)

[0447] Alexa-647-tagged siRNA has the sa...

Embodiment 2

[0470] Embodiment 2: the synthesis of lipid:

[0471] General Preparation (Illustrative Embodiments of Schemes 1-3).

[0472]

[0473]

[0474]

[0475] Method A:

[0476]Compound (i) or an amine functional compound as defined above is conjugated to a fatty acid via standard EDC / NHC coupling methods to give compound (ii). Further reduction with lithium aluminum hydride (LAH) followed by purification by column chromatography on silica gel gave the desired final compound (iii).

[0477] Method B:

[0478] Compound (i) and / or the amine functional compound and the corresponding aldehyde of the alkyl / alkenyl aliphatic chain were stirred at room temperature under argon for 2 hours, followed by NaCNBH 4 or sodium triacetoxyborohydride, and purified by silica gel column chromatography to give the desired final compound.

[0479] Method C:

[0480] Compound (i) or an amine functional compound as defined above is heated overnight with the corresponding alkyl / alkenyl brom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
Login to View More

Abstract

The present invention provides cationic lipids and lipid nanoparticle formulations comprising these lipids, alone or in combination with other lipids. These lipid nanoparticles may be formulated withnucleic acids to facilitate their intracellular delivery both in vitro and for therapeutic applications. The present invention also provides methods of chemical synthesis of these lipids, lipid nanoparticle preparation and formulation with nucleic acids.

Description

[0001] Field of invention [0002] The present invention provides cationic lipids and lipid nanoparticle formulations including these lipids alone or in combination with other lipids. These lipid nanoparticles can be formulated with nucleic acids to facilitate their intracellular delivery for both in vitro and in vivo therapeutic applications. The present invention also provides chemical synthesis methods of these lipids, preparation of lipid nanoparticles and preparations with nucleic acids. [0003] Background of the invention [0004] Therapeutic nucleic acids, including small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, messenger RNA (mRNA), ribozymes, pDNA, and immunostimulatory nucleic acids, exert their effects through multiple mechanisms. Specific proteins can be down-regulated by siRNA or miRNA through RNA interference (RNAi). Hematopoietic cells such as leukocytes in general, and primary T lymphocytes and B cells in particular, are notoriou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07D295/04C07D295/12C07D295/08C07C233/00C07C219/04C07C229/02C07D233/66C07C279/04C07C333/10C07C59/01C07C243/10A61P35/00A61P29/00A61K47/18A61K48/00
CPCA61K48/00A61P29/00A61P35/00C07C229/10C07C243/14C07C243/26C07D233/64C07D295/13C07D295/15A61K47/18C07C211/22C07C215/08C07C229/12C07C243/00C07C243/16C07C243/28C12N15/113C12N2310/14C07C59/01C07C333/10C07C219/04C07C229/02C07C233/00C07C279/04C07C243/10
Inventor丹·培尔斯里尼瓦·拉米谢蒂
OwnerRAMOT AT TEL AVIV UNIV LTD