Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing mRNA and application of the mRNA in tumor treatment

A DNA molecule and sequence technology, applied in the preparation of OX40L mRNA, the application field of tumor treatment, can solve the problems of low transcription and translation efficiency, difficult mass production and preparation, no optimization of UTR and codons, etc., to improve mRNA translation efficiency. , the effect of inhibiting growth

Pending Publication Date: 2019-10-15
SUZHOU GENEPHARMA +1
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ordinary in vitro transcription techniques usually target specific genes without optimized UTRs and codons, resulting in low transcription and translation efficiency, and it is difficult to produce in large quantities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing mRNA and application of the mRNA in tumor treatment
  • Method for preparing mRNA and application of the mRNA in tumor treatment
  • Method for preparing mRNA and application of the mRNA in tumor treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Embodiment 1, different cap modified mcherry mRNA and its cell transfection experiment

[0081] 1. Preparation of mcherry mRNA with different cap modifications

[0082] 1. Preparation of templates for in vitro transcription

[0083] Using the mcherry vector as a template, the T7 universal primer (GGCTGCGCAACTGTTGGGAAGG) and the reverse universal primer (ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttGCCGCCCACTCAGACTTTATTCAAAGACCACTG) were used for PCR amplification to obtain a PCR product (linearized DNA), which in turn included the T7 promoter, 5'UTR, and mcherry code Gene sequence and polyadenylation sequence (30 base A). Wherein, the 5'UTR sequence is the sequence shown in the control group in Table 1.

[0084] The PCR reaction system (50 μl) is as follows: 2Xmax Buffer 25 μl, dNTP 1 μl, mcherry carrier 2 μl (10 ng / μl), T7 universal primer 2 μl, reverse universal primer 2 μl, max enzyme 1 μl, DEPC water to make up 50 μl. Unless otherwise spe...

Embodiment 2

[0105] Example 2, mcherry mRNA prepared with differently modified U as a substrate and its cell transfection experiment

[0106] 1. Preparation of mcherry mRNA with different modified U as substrates

[0107] 1. Preparation of templates for in vitro transcription

[0108] Using the mcherry vector as a template, T7 universal primers and reverse universal primers were used for PCR amplification to obtain a PCR product (linearized DNA), which sequentially included the T7 promoter, 5'UTR, mcherry coding gene sequence and polyadenylation Nucleotide sequence (30 bases A). Wherein, the 5'UTR sequence is the sequence shown in the control group in Table 1.

[0109] The PCR reaction system (50 μl) is as follows: 2Xmax Buffer 25 μl, dNTP 1 μl, mcherry carrier 2 μl (10 ng / μl), T7 universal primer 2 μl, reverse universal primer 2 μl, max enzyme 1 μl, DEPC water to make up 50 μl. Unless otherwise specified, the reagents in the PCR reaction system are all products in the PhantaMax Super-F...

Embodiment 3

[0131] Example 3, mcherry mRNA prepared by different 5'UTR sequences and its cell transfection experiment

[0132] 1. Method for preparing mcherry mRNA with different 5'UTR sequences

[0133] 1. Preparation of templates for in vitro transcription

[0134] Using the mcherry vector as a template, different 5'UTR+T7 universal primers (primer sequences are miniUTR3, miniUTR3+3kozrk, miniUTR7, miniUTR7+3kozrk, T7 universal primers (control group) in Table 1) and reverse universal primers were used Perform PCR amplification to obtain PCR products (linearized DNA) respectively, and the PCR products sequentially include T7 promoter, 5'UTR, mcherry coding gene sequence and polyadenylation sequence. The 5'UTR sequences are the sequences shown in Sequences 1-4 and the sequences shown in the control group in Table 1, respectively.

[0135] The PCR reaction system (50 μl) was as follows: 25 μl of 2Xmax Buffer, 1 μl of dNTP, 2 μl of mcherry carrier (10 ng / μl), 2 μl of different 5’UTR+T7 u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing an mRNA and application of the mRNA in tumor treatment. The invention further discloses a nucleic acid molecule, which comprises a promoter, a transcribable segment A, a transcribable segment B, a transcribable segment C and a polyadenylic acid sequence in turn. Driven by the promoter, the transcribable segment A, the transcribable segment B, the transcribable segment C and the polyadenylic acid sequence can be co-transcribed to produce a common transcript; the segment A encodes a 5'-end untranslated region in the common transcript; the segment Cencodes a 3'-end untranslated region in the common transcript; the transcribable segment A is a DNA molecule shown as sequences 1-4; and the transcribable segment C is a DNA molecule shown as sequences 5-8. The mRNA molecule is obtained by in vitro transcription adopting the nucleic acid molecule as a template. The nucleic acid molecule or mRNA molecule provided can be used for preparing medicinesfor treating various tumors.

Description

technical field [0001] The invention belongs to the field of biotechnology and treatment, and specifically relates to a preparation method of mRNA and its application in tumor treatment, in particular to a preparation method of OX40L mRNA and its application in tumor treatment. Background technique [0002] Messenger RNA (mRNA) is usually a single-stranded ribonucleic acid that is transcribed from DNA in organisms, carries genomic information and can be translated into proteins. Eukaryotic mRNA generally consists of a cap structure (CAP) at the 5' end, an untranslated region at the 5' end (5'UTR), a translated region (CDS), an untranslated region at the 3' end (3'UTR) and a polymer at the 3' end. Nucleotide tail (Poly(A)) composition. The cap is generally composed of m7G, and also contains modifications such as m6A. The transcription of mRNA usually follows the principle of complementary base pairing. Unlike DNA, mRNA has no thymine (T), but uracil (U) instead of thymine (...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/10A61K48/00A61K38/17A61P35/00
CPCC07K14/70575C12N15/10A61K48/005A61K38/177A61P35/00
Inventor 胡荣宽李琴王晓娜张佩琢
Owner SUZHOU GENEPHARMA