Method for preparing mRNA and application of the mRNA in tumor treatment
A DNA molecule and sequence technology, applied in the preparation of OX40L mRNA, the application field of tumor treatment, can solve the problems of low transcription and translation efficiency, difficult mass production and preparation, no optimization of UTR and codons, etc., to improve mRNA translation efficiency. , the effect of inhibiting growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Embodiment 1, different cap modified mcherry mRNA and its cell transfection experiment
[0081] 1. Preparation of mcherry mRNA with different cap modifications
[0082] 1. Preparation of templates for in vitro transcription
[0083] Using the mcherry vector as a template, the T7 universal primer (GGCTGCGCAACTGTTGGGAAGG) and the reverse universal primer (ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttGCCGCCCACTCAGACTTTATTCAAAGACCACTG) were used for PCR amplification to obtain a PCR product (linearized DNA), which in turn included the T7 promoter, 5'UTR, and mcherry code Gene sequence and polyadenylation sequence (30 base A). Wherein, the 5'UTR sequence is the sequence shown in the control group in Table 1.
[0084] The PCR reaction system (50 μl) is as follows: 2Xmax Buffer 25 μl, dNTP 1 μl, mcherry carrier 2 μl (10 ng / μl), T7 universal primer 2 μl, reverse universal primer 2 μl, max enzyme 1 μl, DEPC water to make up 50 μl. Unless otherwise spe...
Embodiment 2
[0105] Example 2, mcherry mRNA prepared with differently modified U as a substrate and its cell transfection experiment
[0106] 1. Preparation of mcherry mRNA with different modified U as substrates
[0107] 1. Preparation of templates for in vitro transcription
[0108] Using the mcherry vector as a template, T7 universal primers and reverse universal primers were used for PCR amplification to obtain a PCR product (linearized DNA), which sequentially included the T7 promoter, 5'UTR, mcherry coding gene sequence and polyadenylation Nucleotide sequence (30 bases A). Wherein, the 5'UTR sequence is the sequence shown in the control group in Table 1.
[0109] The PCR reaction system (50 μl) is as follows: 2Xmax Buffer 25 μl, dNTP 1 μl, mcherry carrier 2 μl (10 ng / μl), T7 universal primer 2 μl, reverse universal primer 2 μl, max enzyme 1 μl, DEPC water to make up 50 μl. Unless otherwise specified, the reagents in the PCR reaction system are all products in the PhantaMax Super-F...
Embodiment 3
[0131] Example 3, mcherry mRNA prepared by different 5'UTR sequences and its cell transfection experiment
[0132] 1. Method for preparing mcherry mRNA with different 5'UTR sequences
[0133] 1. Preparation of templates for in vitro transcription
[0134] Using the mcherry vector as a template, different 5'UTR+T7 universal primers (primer sequences are miniUTR3, miniUTR3+3kozrk, miniUTR7, miniUTR7+3kozrk, T7 universal primers (control group) in Table 1) and reverse universal primers were used Perform PCR amplification to obtain PCR products (linearized DNA) respectively, and the PCR products sequentially include T7 promoter, 5'UTR, mcherry coding gene sequence and polyadenylation sequence. The 5'UTR sequences are the sequences shown in Sequences 1-4 and the sequences shown in the control group in Table 1, respectively.
[0135] The PCR reaction system (50 μl) was as follows: 25 μl of 2Xmax Buffer, 1 μl of dNTP, 2 μl of mcherry carrier (10 ng / μl), 2 μl of different 5’UTR+T7 u...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap