Attenuated live vaccine for preventing toxoplasma gondii infection and application of attenuated live vaccine

A technology of live attenuated vaccine and Toxoplasma gondii, applied in anti-infective drugs, medical preparations containing active ingredients, invertebrate antigen components, etc., can solve problems such as unsatisfactory immune protection effect and inability to achieve complete protection

Pending Publication Date: 2019-10-29
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research and development of toxoplasmosis vaccines mainly focus on inactivated vaccines, subunit vaccines, nucleic acid vaccines, etc., but suc

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Attenuated live vaccine for preventing toxoplasma gondii infection and application of attenuated live vaccine
  • Attenuated live vaccine for preventing toxoplasma gondii infection and application of attenuated live vaccine
  • Attenuated live vaccine for preventing toxoplasma gondii infection and application of attenuated live vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A preparation method of a live attenuated vaccine for preventing Toxoplasma gondii infection according to the present invention, the implementation steps are as follows:

[0029] 1. Construction of knockout plasmid:

[0030] According to the GRA17 gene (TGME49_222170) in the Toxoplasma genome website TOXODB, the sgRNA was designed: GACTGTCCCTGAGGACCCAT and then the sgRNA in pSAG1::Cas9::U6sgUPRT was replaced by GRA17 using the Q5 site-directed mutagenesis kit to construct the plasmid pSAG1::Cas9::U6sgGRA17; DHFR-resistant fragments DHFR-F: AAGCTTTTACATCCGTTGC and DHFR-R: GAATTCCTGGCGAAATCAA were amplified from plasmid pUPRT-DHFR-D by primers;

[0031] NPT1 (TGME49_215490) gene design sgRNA: GATGAAGTGCAAGCTCCCG and then use Q5 site-directed mutagenesis kit to replace the sgRNA in pSAG1::Cas9::U6sgUPRT with NPT1 to construct plasmid pSAG1::Cas9::U6sgNPT1;

[0032] Ble-F: AAGCTTTTACATCCGTTGC and Ble-R: GAATTCCTGGCGAAATCAA were amplified from plasmid pSAG1-Ble by primers;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an attenuated live vaccine for preventing toxoplasma gondii infection and application of the attenuated live vaccine. The attenuated live vaccine is tachyzoite suspension, prepared by taking PBS as a solvent, of a toxoplasma gondii attenuated stain RH: delta gra17 delta npt 1. Toxoplasma gondii double gene knockout is conducted, the immune dosage form of the attenuated livevaccine is determined, the immune vaccination program and dosage of the attenuated live vaccine are verified, it is found that the attenuated live vaccine has a good immune protection effect on toxoplasma gondii acute infection, chronic infection and congenital infection, and toxoplasmosis can be effectively prevented.

Description

technical field [0001] The invention relates to the field of live attenuated vaccines of Toxoplasma gondii, in particular to a live attenuated vaccine for preventing Toxoplasma gondii infection and its application. Background technique [0002] Toxoplasma gondii is an obligate intracellular parasitic opportunistic pathogenic protozoa that can infect almost all warm-blooded animals, including humans, and is widely distributed worldwide. Toxoplasma gondii is an opportunistic pathogen. When humans ingest raw meat containing T. gondii tissue cysts or water contaminated with oocysts in cat feces, the oocysts or tissue cysts rupture, and the parasite invades intestinal mucosal cells and oocysts. The released sporozoites or bradyzoites released from tissue cysts are transformed into tachyzoites, which are eventually distributed to various parts of the body, causing the host to infect the host with Toxoplasma gondii. After a person with normal immunity is infected with Toxoplasma g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/00A61P33/02
CPCA61K39/0003A61P33/02
Inventor 梁勤立王金磊侯俊玲聂兰碧李涛善孙黎秀白梦捷朱兴全
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap