Nanocomposite of DNA tetrahedron and microRNA
A technology of nanocomposites and tetrahedrons, which is applied in the direction of drug combinations, medical preparations with non-active ingredients, and medical preparations containing active ingredients. The effect of high cell efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 The preparation method of nanocomposite (TDN-miR) of the present invention
[0038] 1. Synthesis method
[0039] Dissolve four DNA single strands (S1, S2, S3-miR214-3p, S4) in TM Buffer (10 mM Tris-HCl, 50 mM MgCl 2 , pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix thoroughly, heat rapidly to 95°C for 10 minutes, then rapidly cool down to 4°C and maintain for more than 20 minutes, you can get the DNA four sides with miRNA body.
[0040] The sequences of the four single strands (5'→3') are as follows:
[0041] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1);
[0042] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2);
[0043] S3-miR214-3p: acagcaggcacagacaggcaguTTTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.3); the lowercase part is the miR214-3p sequence, and the u base in the miR214-3p sequence can be replaced with a t bas...
experiment example 1
[0050] Experimental Example 1 Serum Incubation Experiment
[0051] 1. Method
[0052] 1.1 Synthesis of TDN-miR
[0053] With embodiment 1.
[0054] 1.2 Incubation and detection
[0055]The initial concentration of miR was 1000nM, and it was mixed with serum at a volume ratio of 99:1, so that miR was in a 1% serum environment, incubated in a 37°C incubator, and used capillary gel at 1min, 5min, and 30min Electrophoresis was used for detection, and 1000nM miR not mixed with serum was also detected by capillary gel electrophoresis.
[0056] TDN, miR, TDN-miR with an initial concentration of 1000nM was mixed with 10% serum, incubated in a 37°C incubator, and detected by agarose gel electrophoresis after 24 hours.
[0057] 2. Results
[0058] The microRNA is completely degraded after 30 minutes in the environment of 1% serum, where red: 1000nM miR without 1% serum, blue: 1000nM miR with 1% serum for 1 minute, green: 1% serum for 5 minutes 1000nM miR, Huang: Add 1000nM miR in ...
experiment example 2
[0060] Experimental Example 2 Tumor Cell Inhibition Experiment
[0061] 1. Method
[0062] 1.1 Synthesis of TDN-miR
[0063] With embodiment 1.
[0064] 1.2 Inhibition experiment
[0065] The experimental group used DMEM-F12 medium containing TDN-miR with a final concentration of 150nM to culture lung cancer cell A549; the control group treated lung cancer cell A549 with DMEM-F12 medium containing TDN with a final concentration of 150nM; the blank group used Lung cancer cell A549 was cultured in DMEM-F12 medium.
[0066] After culturing for 72 hours, the cells were observed under a microscope, and the level of apoptosis was detected by flow cytometry.
[0067] 2. Results
[0068] Microscopic examination results of Image 6 As shown, the number of lung cancer cells treated with TDN-miR was much lower than that of the control group and the blank group, and the morphology of lung cancer cells treated with TDN-miR was relatively shrunken.
[0069] Flow cytometry results ( ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap