Nanocomposite of DNA tetrahedron and microRNA

A technology of nanocomposites and tetrahedrons, which is applied in the direction of drug combinations, medical preparations with non-active ingredients, and medical preparations containing active ingredients. The effect of high cell efficiency

Active Publication Date: 2019-11-05
SICHUAN UNIV
View PDF12 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]There is no report about DNA tetrahedron being used as miRNA carrier

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanocomposite of DNA tetrahedron and microRNA
  • Nanocomposite of DNA tetrahedron and microRNA
  • Nanocomposite of DNA tetrahedron and microRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 The preparation method of nanocomposite (TDN-miR) of the present invention

[0038] 1. Synthesis method

[0039] Dissolve four DNA single strands (S1, S2, S3-miR214-3p, S4) in TM Buffer (10 mM Tris-HCl, 50 mM MgCl 2 , pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix thoroughly, heat rapidly to 95°C for 10 minutes, then rapidly cool down to 4°C and maintain for more than 20 minutes, you can get the DNA four sides with miRNA body.

[0040] The sequences of the four single strands (5'→3') are as follows:

[0041] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1);

[0042] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2);

[0043] S3-miR214-3p: acagcaggcacagacaggcaguTTTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.3); the lowercase part is the miR214-3p sequence, and the u base in the miR214-3p sequence can be replaced with a t bas...

experiment example 1

[0050] Experimental Example 1 Serum Incubation Experiment

[0051] 1. Method

[0052] 1.1 Synthesis of TDN-miR

[0053] With embodiment 1.

[0054] 1.2 Incubation and detection

[0055]The initial concentration of miR was 1000nM, and it was mixed with serum at a volume ratio of 99:1, so that miR was in a 1% serum environment, incubated in a 37°C incubator, and used capillary gel at 1min, 5min, and 30min Electrophoresis was used for detection, and 1000nM miR not mixed with serum was also detected by capillary gel electrophoresis.

[0056] TDN, miR, TDN-miR with an initial concentration of 1000nM was mixed with 10% serum, incubated in a 37°C incubator, and detected by agarose gel electrophoresis after 24 hours.

[0057] 2. Results

[0058] The microRNA is completely degraded after 30 minutes in the environment of 1% serum, where red: 1000nM miR without 1% serum, blue: 1000nM miR with 1% serum for 1 minute, green: 1% serum for 5 minutes 1000nM miR, Huang: Add 1000nM miR in ...

experiment example 2

[0060] Experimental Example 2 Tumor Cell Inhibition Experiment

[0061] 1. Method

[0062] 1.1 Synthesis of TDN-miR

[0063] With embodiment 1.

[0064] 1.2 Inhibition experiment

[0065] The experimental group used DMEM-F12 medium containing TDN-miR with a final concentration of 150nM to culture lung cancer cell A549; the control group treated lung cancer cell A549 with DMEM-F12 medium containing TDN with a final concentration of 150nM; the blank group used Lung cancer cell A549 was cultured in DMEM-F12 medium.

[0066] After culturing for 72 hours, the cells were observed under a microscope, and the level of apoptosis was detected by flow cytometry.

[0067] 2. Results

[0068] Microscopic examination results of Image 6 As shown, the number of lung cancer cells treated with TDN-miR was much lower than that of the control group and the blank group, and the morphology of lung cancer cells treated with TDN-miR was relatively shrunken.

[0069] Flow cytometry results ( ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nanocomposite of DNA tetrahedron and microRNA, and belongs to the field of nucleic acid molecular medicine. The nanocomposite of the invention is composed of microRNA and a DNA tetrahedron; the DNA tetrahedron is a tetrahedral structure formed by base pairing of four DNA single strands; and the microRNA is covalently linked to a single strand of the DNA tetrahedron. The nanocomposite of the invention has strong stability and high cell entry efficiency, can be developed into various microRNA-related drugs, and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of nucleic acid molecular medicines, in particular to a nanocomposite of DNA tetrahedron and microRNA. Background technique [0002] microRNA (miRNA, miR) is a kind of non-coding single-stranded RNA molecule encoded by endogenous genes with a length of about 22nt. It exists widely in animals and plants and has a variety of biological functions. It participates in gene transcription and post-transcriptional regulation. [0003] Researchers have used the biological functions of miRNAs to apply them in various fields, such as regeneration, targeted therapy, and so on. However, miRNA has the same disadvantages as other RNAs, that is, its own stability is extremely poor, and its ability to enter cells is not good. Therefore, its wide application in many fields is extremely limited. At present, the main method of carrying microRNA into cells is liposome delivery. The surface of cationic liposome is positively charged, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K47/54A61K31/7105A61P35/00
CPCA61K47/549A61K31/7105A61P35/00
Inventor林云锋李松航田陶然秦鑫蔡潇潇
OwnerSICHUAN UNIV