Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of ub2/ub3 Genes in Regulating the Development of Multiple Ears in Maize

The technology of UB2 and 1.UB2 is applied in the field of maize genetics and breeding, which can solve the problems of unclear cultivation conditions for regulating the number of ears and dense planting, and achieve the effect of great application prospects.

Active Publication Date: 2021-08-31
SOUTH CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of ZmUB2 / UB3 in regulating ear number and how it responds to dense planting conditions is still unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ub2/ub3 Genes in Regulating the Development of Multiple Ears in Maize
  • Application of ub2/ub3 Genes in Regulating the Development of Multiple Ears in Maize
  • Application of ub2/ub3 Genes in Regulating the Development of Multiple Ears in Maize

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Construction of CRISPR / Cas9 Transgenic Plants of Maize UB2 and UB3 Genes

[0026] 1. Method

[0027] The construction process of the CRISPR / Cas9 knockout vector of UB2 (SEQ ID NO: 1) and UB3 gene (SEQ ID NO: 2) is as follows: first, use SnapGene Viewer software and homologous sequence alignment to design and screen UB2 / UB3 gene-specific The target sequence (sgRNA), in order to ensure the efficiency of gene editing, select two optimal target sequences for each gene:

[0028] UB2: CCA GCTGCCTGAATTCGACC (SEQ ID NO: 3),

[0029] CCA GTTCTCAGGTGAGCTCGAGC (SEQ ID NO: 4);

[0030] UB3: CCA CAACCTGGCCGAATTTGACC (SEQ ID NO: 5),

[0031] GGTTCGACCTGGTGGTGAAA GGG (SEQ ID NO: 6);

[0032] These target sequences are then introduced into the sgRNA expression cassette. Meanwhile, the human hSpCas9 sequence was used in commercial The PCR Cloning Kit kit was cloned into the pCPB vector and constructed as pCPB-ZmUbi:hSpCas9 vector. Next, pass the two sgRNA expre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of UB2 / UB3 genes in regulating the development of multiple ears of corn, specifically the application of double mutations of UB2 and UB3 genes in regulating the development of multiple ears of corn. The present invention uses CRISPR / Cas9 transgenic technology to edit the genes of UB2 and UB3 in corn, so that the target site of UB2 gene has a base deletion, resulting in a frameshift mutation, while the UB3 gene is a large fragment Deleted; the results showed that the number of tassel branches in UB2 and UB3 double mutant plants decreased, and it was observed for the first time that the UB2 and UB3 double mutant had an increase in the number of ears, and a new ear grew on the peduncle of the main ear, showing Multi-eared, the lower axillary meristems are also derepressed to develop into ears, and accompanied by the phenotype of increased aerial roots; it shows that after knocking out the UB2 and UB3 genes, the maize mutant plants can show a multi-eared phenotype, The invention provides a theoretical basis for the genetic improvement of corn multiple ears, and has great application prospects.

Description

technical field [0001] The invention relates to the technical field of maize genetics and breeding, and more specifically relates to the application of UB2 / UB3 genes in regulating the development of multiple ears of maize. Background technique [0002] Maize (Latin scientific name: Zea mays L.) is an annual herbaceous plant of the Poaceae Maize genus. Maize is an annual monoecious cross-pollinated plant with tall plants and strong stems. The highest crop, its planting area and total output are second only to rice and wheat. Reasonably increasing maize planting density is one of the effective ways to increase maize yield per unit area, but the light quality change (low R / FR ratio) brought about by dense planting will trigger a series of shade avoidance responses in plants: such as increased plant height and ear height, resistance Poor lodging ability, reduced leaf area, reduced branching, prolonged flowering interval between male and female flowers, decreased seed setting ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/29C12N15/10A01H5/00A01H5/08A01H6/46
CPCC07K14/415C12N15/102C12N15/8218C12N15/8261
Inventor 王海洋孔德鑫魏洪彬王宝宝赵永平刘宇婷赵斌斌李全权薛伟聪
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More