Application of UB2/UB3 gene in regulation and control of corn multi-spike development

A UB2, 1.UB2 technology, applied in the field of corn genetics and breeding, can solve the problems of regulating the number of ears and dense planting conditions, etc., and achieve the effect of great application prospects

Active Publication Date: 2019-12-17
SOUTH CHINA AGRI UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of ZmUB2 / UB3 in regulating ear number and how it responds to dense planting conditions is still unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of UB2/UB3 gene in regulation and control of corn multi-spike development
  • Application of UB2/UB3 gene in regulation and control of corn multi-spike development
  • Application of UB2/UB3 gene in regulation and control of corn multi-spike development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Construction of CRISPR / Cas9 Transgenic Plants of Maize UB2 and UB3 Genes

[0026] 1. Method

[0027] The construction process of the CRISPR / Cas9 knockout vector of UB2 (SEQ ID NO: 1) and UB3 gene (SEQ ID NO: 2) is as follows: first, use SnapGene Viewer software and homologous sequence alignment to design and screen UB2 / UB3 gene-specific The target sequence (sgRNA), in order to ensure the efficiency of gene editing, select two optimal target sequences for each gene:

[0028] UB2: CCA GCTGCCTGAATTCGACC (SEQ ID NO: 3),

[0029] CCA GTTCTCAGGTGAGCTCGAGC (SEQ ID NO: 4);

[0030] UB3: CCA CAACCTGGCCGAATTTGACC (SEQ ID NO: 5),

[0031] GGTTCGACCTGGTGGTGAAA GGG (SEQ ID NO: 6);

[0032] These target sequences are then introduced into the sgRNA expression cassette. Meanwhile, the human hSpCas9 sequence was used in commercial The PCR Cloning Kit kit was cloned into the pCPB vector and constructed as pCPB-ZmUbi:hSpCas9 vector. Next, pass the two sgRNA expre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a UB2 / UB3 gene in regulation and control of corn multi-spike development, and particularly relates to application of UB2 and UB3 gene double mutation in regulation and control of corn multi-spike development. According to the invention, gene editing is carried out on two targets UB2 and UB3 in corn by using a CRISPR / Cas9 transgenic technology, so that the target site of the UB2 gene has deletion of a basic group to cause frameshift mutation and deletion of large fragments of the UB3 gene. Results show that the tassel branch number of UB2 and UB3 double mutant plants is reduced, the increase of the spike number of the UB2 and UB3 double mutants is observed for the first time, new female spikes grow on spike stalks of main spikes, the multi-spike property is shown, auxiliary meristem at the lower part is also derepressed to be developed into female spikes, and phenotypes with increased aerial roots are accompanied; and it shows that after the UB2 gene and the UB3 gene are knocked out, a corn mutant plant can show a multi-spike phenotype. The invention provides a theoretical basis for genetic improvement of the corn multi-spike property has a large application prospect.

Description

technical field [0001] The invention relates to the technical field of maize genetics and breeding, and more specifically relates to the application of UB2 / UB3 genes in regulating the development of multiple ears of maize. Background technique [0002] Maize (Latin scientific name: Zea mays L.) is an annual herbaceous plant of the Poaceae Maize genus. Maize is an annual monoecious cross-pollinated plant with tall plants and strong stems. The highest crop, its planting area and total output are second only to rice and wheat. Reasonably increasing maize planting density is one of the effective ways to increase maize yield per unit area, but the light quality change (low R / FR ratio) brought about by dense planting will trigger a series of shade avoidance responses in plants: such as increased plant height and ear height, resistance Poor lodging ability, reduced leaf area, reduced branching, prolonged flowering interval between male and female flowers, decreased seed setting ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29C12N15/10A01H5/00A01H6/46
CPCC07K14/415C12N15/102C12N15/8218C12N15/8261
Inventor 王海洋孔德鑫魏洪彬王宝宝赵永平刘宇婷赵斌斌李全权薛伟聪
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap