Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of IU1 in preparing drugs for treating p53-deficient tumors

A defect, tumor technology, applied in the field of tumor drugs, can solve problems such as difficulty in obtaining clinical efficacy

Active Publication Date: 2020-01-10
SHANGHAI TENTH PEOPLES HOSPITAL
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, limited by technical means, it is still not possible to introduce tumor suppressor genes into most cells in living tumors, so it is difficult to obtain better clinical efficacy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of IU1 in preparing drugs for treating p53-deficient tumors
  • Application of IU1 in preparing drugs for treating p53-deficient tumors
  • Application of IU1 in preparing drugs for treating p53-deficient tumors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Spontaneous tumor formation and the therapeutic effect of IU1 were observed with p53 heterozygous knockout mice and p53 homozygous knockout mice.

[0023] All experimental procedures were approved by the guidelines of the Animal Care and Use Committee (IACUC) of Tongji University School of Medicine (SYDW-19-215). Experiments were performed in 9-month-old wild-type and p53 heterozygous knockout (p53+ / -) mice and 3-month-old p53 homozygous knockout (p53- / -) mice. Genomic DNA from tail biopsies was genotyped using Trp53-based polymerase chain reaction (PCR). The reaction system of PCR is as follows:

[0024]

[0025] Among them, oIMR7777 5'ACAGCGTGGTGGTACCTTAT3' (SEQ ID No.1);

[0026] oIMR7778 5'TATACTCAGAGCCGGCCT3' (SEQ ID No. 2);

[0027] oIMR8306 5'CTATCAGGACATAGCGTTGG3' (SEQ ID No. 3).

[0028] The PCR amplification procedure is as follows:

[0029]

[0030]

[0031] Mice were treated by intraperitoneal injection twice a week. The main components of the...

Embodiment 2

[0035] Imaging analysis of IU1 inhibits the number and type of tumors generated in p53 gene homozygous deficient mice

[0036] Utilize conventional X-ray, MICRO-CT and MRI to analyze the location, quantity and type of mouse tumors.

[0037] The result is as figure 2 shown. figure 2 X-ray, MICRO-CT and MRI analysis and typing of primary tumors in p53 gene homozygous deficient mice. p53 gene homozygous deficient mouse MLT ( figure 2 -A), p53 gene homozygous deficient mouse STS ( figure 2 -B) and p53 gene homozygous deficient mouse OSA ( figure 2 -C) X-ray, MICRO-CT and MRI analysis. figure 2 -D is the effect of IU1 on the number of cancer types in wild type, p53 heterozygous knockout mice and p53 homozygous knockout mice. figure 2 -E is the number of mice with MLT or OSA in p53 heterozygous knockout mice and p53 homozygous knockout mice. CTRL, control group; MLT, thymic malignant lymphoma; MOCK, untreated mice; NA, not applicable; OSA, osteosarcoma; STS, soft tissu...

Embodiment 3

[0040] The molecular mechanism of IU1 tumor suppressor was verified by primary cancer cells and tumor tissues of mice spontaneously forming tumors

[0041] Mouse spontaneous tumorigenic primary cancer cells were cultured in DMEM medium containing 10% (V / V) fetal bovine serum (FBS), 100 μg / ml penicillin, and 100 mg / ml streptomycin, and flow cytometry was performed. Experiments analyzing the effect of IU1 on the cell cycle and distribution in p53 heterozygous knockout mice.

[0042] Conventional Western blotting analysis was used to detect the protein levels of cell cycle, senescence and apoptosis-related markers in p53 heterozygous knockout mice.

[0043] The detailed experimental steps are as follows: use the lysate to lyse the tissue sample, and use the BCA protein concentration assay kit to measure the protein concentration of the sample. Add an appropriate amount of concentrated SDS-PAGE protein loading buffer to the collected protein samples. Heat at 100°C or in a boilin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of IU1 in preparing drugs for treating p53-deficient tumors, and belongs to the technical field of antitumor drugs. The application of the IU1 with a structure shownin a formula I in preparing the drugs for treating the p53-deficient tumors is disclosed. The application of the small-molecular inhibitor IU1 in specifically inhibiting deubiquitinating enzymes USP14 causes persistent tumor regression of p53-deficient mouse in-vivo lymphomas and sarcomas and does not influence normal tissue, and therapeutic reaction is related to COPS5 ubiquitin increments. Through COPS5 deubiquitinating of the USP14, a p53-dependent regulatory mechanism and a p53-independent regulatory mechanism, the IU1 specifically inhibits the USP14 and accordingly causes persistent tumor regression.

Description

technical field [0001] The invention belongs to the technical field of tumor drugs, and in particular relates to the application of IU1 in the preparation of drugs for treating p53-deficient tumors. Background technique [0002] Oncogenes and tumor suppressor genes play a very important role in the occurrence of cancer. Oncogenes are a mutation of normal genes (also known as proto-oncogenes) that control cell growth and division, and can cause normal cells to become cancerous. The proteins encoded by oncogenes mainly include growth factors, growth factor receptors, molecules in signal transduction pathways, gene transcription regulators, and cell cycle regulatory proteins. Tumor suppressor gene is a negative regulatory factor in the process of normal cell proliferation, and the protein encoded by it often plays a role in preventing the cycle process at the cell cycle checkpoint. The occurrence of cancer is the result of the accumulation of genetic mutations. In 1979, David...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/4025A61P35/00
CPCA61K31/4025A61P35/00
Inventor 符达马雨水
Owner SHANGHAI TENTH PEOPLES HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More