Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of iu1 in the preparation of drugs for the treatment of p53-deficient tumors

A defect, tumor technology, applied in the field of tumor drugs, can solve problems such as difficulty in obtaining clinical efficacy

Active Publication Date: 2022-08-02
SHANGHAI TENTH PEOPLES HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, limited by technical means, it is still not possible to introduce tumor suppressor genes into most cells in living tumors, so it is difficult to obtain better clinical efficacy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of iu1 in the preparation of drugs for the treatment of p53-deficient tumors
  • Application of iu1 in the preparation of drugs for the treatment of p53-deficient tumors
  • Application of iu1 in the preparation of drugs for the treatment of p53-deficient tumors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Spontaneous tumor formation and the therapeutic effect of IU1 were observed in p53 heterozygous knockout mice and p53 homozygous knockout mice.

[0023] All experimental procedures were approved by the guidelines of the Animal Care and Use Committee (IACUC) of Tongji University School of Medicine (SYDW-19-215). Experiments were performed in 9-month-old wild-type and p53 heterozygous knockout (p53+ / -) mice and 3-month-old p53 homozygous knockout (p53- / -) mice. Genotyping of genomic DNA from tail biopsies was performed using Trp53-based polymerase chain reaction (PCR). The PCR reaction system is as follows:

[0024]

[0025]

[0026] Wherein, oIMR7777 5'ACAGCGTGGTGGTACCTTAT3' (SEQ ID No.1);

[0027] oIMR7778 5'TATACTCAGAGCCGGCCT3' (SEQ ID No. 2);

[0028] oIMR8306 5' CTATCAGGACATAGCGTTGG3' (SEQ ID No. 3).

[0029] The PCR amplification procedure is as follows:

[0030]

[0031] Mice treatments were administered as twice weekly intraperitoneal injections. The ...

Embodiment 2

[0035] Imaging analysis of IU1 suppresses the number and type of tumors in p53-deficient mice

[0036] The location, number and type of tumors in mice were analyzed using conventional X-ray, MICRO-CT and MRI.

[0037] The result is as figure 2 shown. figure 2 X-ray, MICRO-CT and MRI analysis and typing of primary tumors in p53 gene homozygous deficient mice. p53 homozygous deficient mouse MLT ( figure 2 -a), p53 gene homozygous deficient mouse STS ( figure 2 -b) and p53 gene homozygous deficient mouse OSA ( figure 2 -c) X-ray, MICRO-CT and MRI analysis. figure 2 -d is the effect of IU1 on the number of cancer types in wild type, p53 heterozygous knockout mice and p53 homozygous knockout mice. figure 2 -e is the number of mice with MLT or OSA in p53 heterozygous knockout mice and p53 homozygous knockout mice. CTRL, control group; MLT, malignant thymic lymphoma; MOCK, untreated mice; NA, not applicable; OSA, osteosarcoma; STS, soft tissue sarcoma; WT, wild type.

...

Embodiment 3

[0040] Validation of the molecular mechanism of IU1 tumor suppressor using primary cancer cells and tumor tissue from spontaneously tumorigenic mice

[0041] Mouse spontaneous tumorigenic primary cancer cells were cultured in DMEM medium containing 10% (V / V) fetal bovine serum (FBS), 100 μg / ml penicillin, and 100 mg / ml streptomycin, and flow cytometry was performed. Experiments analyzing the effect of IU1 on cell cycle and distribution in p53 heterozygous knockout mice.

[0042] Routine Western blotting analysis was used to detect the protein levels of cell cycle, senescence and apoptosis-related markers in p53 heterozygous knockout mice.

[0043] The detailed experimental steps are as follows: using lysis buffer, lyse tissue samples, and use BCA protein concentration assay kit to determine the protein concentration of the samples. Add an appropriate amount of concentrated SDS-PAGE protein loading buffer to the collected protein samples. Heating at 100℃ or boiling water bath...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of IU1 in the preparation of a drug for treating p53-deficient tumors, and belongs to the technical field of tumor drugs. The application of IU1 having the structure shown in formula I in the preparation of a medicament for treating p53-deficient tumors. Specific inhibition of the deubiquitinase USP14 with the small-molecule inhibitor IU1 resulted in persistent tumor regression of lymphomas and sarcomas in p53-deficient mice without affecting normal tissues, and treatment response was associated with increased COPS5 ubiquitination. IU1-specific inhibition of USP14 resulted in durable tumor regression through a mechanism of COPS5 deubiquitination and p53-dependent and independent regulation of USP14.

Description

technical field [0001] The invention belongs to the technical field of tumor drugs, in particular to the application of IU1 in the preparation of a drug for treating p53-deficient tumors. Background technique [0002] Oncogenes and tumor suppressor genes play a very important role in the occurrence of cancer. Oncogenes are a mutated form of normal genes (also known as proto-oncogenes) that control cell growth and division, and can cause normal cells to become cancerous. The proteins encoded by oncogenes mainly include growth factors, growth factor receptors, molecules in signal transduction pathways, gene transcription regulators and cell cycle regulatory proteins. Tumor suppressor genes are negative regulators in the process of normal cell proliferation, and the proteins encoded by them often play a role in preventing cycle progression at cell cycle checkpoints. Cancer occurs as a result of the accumulation of genetic mutations. In 1979, David Lane and Lionel Crawford wer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/4025A61P35/00
CPCA61K31/4025A61P35/00
Inventor 符达马雨水
Owner SHANGHAI TENTH PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com