Split SpCas9 lentiviral vector and application thereof in stem cell gene editing
A lentiviral vector, lentivirus technology, applied in the field of gene editing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0069] 1. Prepare the split SpCas9 vector;
[0070] (1) The Cas9-C vector can be used directly without additional molecular cloning process;
[0071] (2) Design sgRNA targeting GYPA and AAVS1 genes and annealing oligonucleotide chains (Table 1), and perform annealing reaction to obtain sgRNA double-stranded DNA;
[0072] Table 1 sgRNA, primers and annealed oligonucleotide chains
[0073] GYPA sgRNA targeting sequence atctttgtattactattgtc GYPA sgRNA forward annealed oligonucleotide strand caccgatctttgtattactattgtc GYPA sgRNA reverse annealed oligonucleotide strands caccgagcattaagtaccactgagg GYPA upstream detection primers cattagaaatgagaaggtccatggc GYPA downstream detection primers aaactggatttggccataaatactg AAVS1 sgRNA targeting sequence gcaaactctccaagtgacc AAVS1 sgRNA forward annealed oligonucleotide strand caccgagcaaactctccaagtgacc AAVS1 sgRNA reverse annealed oligonucleotide strands aaacggtcacttggagagtttgct AAV...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com