Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

An HLA-A2, single-domain antibody technology, applied in the field of single-domain antibodies, can solve the problems of TCR mismatch, poor progress, difficult TCR acquisition, etc.

Inactive Publication Date: 2020-03-10
SHENZHEN BEIKE BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Despite clinical efficacy, transgenic TCR-based adoptive immunotherapy has made little progress due to difficulty in TCR acquisition and the potential risk of TCR mismatch

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide
  • Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide
  • Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0133] Example 1 Screening of single domain antibodies of HLA-A2 / ITDQVPFSV complex

[0134] 1.1 Preparation of single domain antibody phage library

[0135] 1.1.1 Preparation of helper phage (BM13)

[0136] The M13KE phage (purchased from NEB#N0316S) replicon was digested with AlwnI (purchased from NEB) and AfeI (purchased from NEB), and the artificially synthesized gene fragment was also digested with AlwnI and AfeI (purchased from NEB), and then Connect them with T4 ligase. After ligation, TG1 was transfected to obtain helper phage BM13. In this way, the original replicon tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct sequence is replaced by a synthetic gene sequence, that is, a trypsin cleavage sequence is added to the GIII coding region of the phage, which reduces the number of trypsin cleavage sequences that are used as a helper phage to digest the phage. Number of.

[0137] The synthetic gene sequence is as follows: CCA GCC...

Embodiment 2

[0167] Example 2. Preparation of fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc

[0168] 1. Construction of recombinant vector

[0169] The DNA molecule shown in SEQ ID No. 16 (which includes Kozak sequence and signal peptide, M3-B2 antibody sequence, human Fc sequence and tag sequence) was cloned into the HindⅢ and XbaI restriction endonuclease sites of pcDNA3.1 In time, the recombinant vector pcDNA3.1-M3-B2-Fc was obtained.

[0170] The DNA molecule shown in SEQ ID No.17 (which includes Kozak sequence and signal peptide, M3-D9 antibody sequence, human Fc sequence and tag sequence) was cloned into the HindⅢ and XbaI restriction enzyme sites of pcDNA3.1 In time, the recombinant vector pcDNA3.1-M3-D9-Fc was obtained.

[0171] The DNA molecule shown in SEQ ID No. 18 (including Kozak sequence and signal peptide, M3-E7 antibody sequence, human Fc sequence and tag sequence) was cloned into the HindⅢ and XbaI restriction endonuclease sites of pcDNA3.1 In between, the recombinant vector pcDN...

Embodiment 3

[0178] Example 3. Fusion proteins M3-B2-Fc, M3-D9-Fc, and M3-E7-Fc specifically recognize the HLA-A2 / ITDQVPFSV complex.

[0179] The fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc, and M4-A7-Fc after purification of Protein A were identified by ELISA. The specific steps of ELISA identification are as follows: Dilute the known antigen to 1-10μg / ml with coating buffer, add 0.1ml per well, overnight at 4℃; wash 3 times the next day; add 0.1ml of a certain diluted sample to be tested In the above-mentioned reaction wells coated with antigen, incubate at 37°C for 1 hour and wash; add 0.1ml of freshly diluted enzyme-labeled secondary antibody (horseradish peroxidase HRP-labeled anti-human antibody, 1:5000), Incubate at 37°C for 30 minutes and wash; wash with DDW for the last time. Add 0.1ml of the temporarily prepared TMB substrate solution to each reaction well, and let it stand at 37°C for 10-30 minutes. Use an advanced plate reader to read the plate at 650nm wavelength.

[0180] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a single-domain antibody for recognizing a complex formed by an HLA-A2 molecule and an ITDQVPFSV short peptide. The single-domain antibody has an amino acid sequence shown in SEQ ID No.10 or SEQ ID No.11 or SEQ ID No.12. The invention also discloses a fusion protein obtained by fusing the single-domain antibody and a human-derived Fc protein. Experiments show that the single-domain antibody and fusion protein provided by the invention not only recognize the artificially synthesized HLA-A2 / ITDQVPFSV complex, but also can bind to the HLA-A2 / ITDQVPFSV complex processed bya natural antigen and expressed at the surfaces of tumor cells, and can be further developed into a related tumor treatment product.

Description

Technical field [0001] The invention belongs to the technical field of tumor treatment, and particularly relates to a single domain antibody that recognizes the complex formed by HLA-A2 molecules and ITDQVPFSV short peptides. Background technique [0002] Since the 1940s, the incidence of melanoma has doubled every year. Currently, melanoma ranks the sixth most common cancer among men and the seventh most common cancer among women. All over the world, the incidence of melanoma is rising. The 5-year survival rate of melanoma patients is 30% to 40%, among which the death rate due to the metastasis of malignant melanoma is the highest; if the patients with metastatic melanoma (stage IV) have no effective long-term treatment, standard chemotherapy It will not bring significant long-term survival effects to these patients. Therefore, there is an urgent need to develop new targeted treatment methods for melanoma, which can not only prevent the development of cancer, but also treat a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C07K16/46C12N15/13A61K47/68A61P35/00
CPCC07K16/2833A61K47/6849A61K47/6877A61P35/00C07K2317/32C07K2317/569C07K2317/565C07K2317/567C07K2317/52C07K2317/92C07K2317/33
Inventor梁猛高斌梅小伟郭小飞郭志霞
OwnerSHENZHEN BEIKE BIOTECH