microRNA sequence for early diagnosis of type 2 diabetes and application of microRNA sequence
A technology for early diagnosis of type 2 diabetes, applied in the field of medicine, can solve problems such as unclear mechanism and achieve accurate diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] 1. The research group collected serum of 562 Uyghur individuals and analyzed it using Illumina Infinium GlobalScreening Array-24 v1.0 (GSA) Bead Chip technology, and found a microRNA sequence that was significantly positively correlated with fasting blood glucose. After database comparison, the sequence was determined to be microRNA-X, the sequence of the microRNA is AAAGGUAAUUGUGGUUUCUGC. The primers designed by the research group are as follows:
[0018] F:5'-AAAGGUAAUUGUGGUUUCUGC-3'
[0019] R: 5'-AGAAACCACAAUUACCUUUUU-3'
[0020] 2. Human sample collection:
[0021] (1) Sample grouping and source: From December 2016 to December 2018, in Kashgar, Ili and Shihezi areas of Xinjiang Uygur Autonomous Region, 24 normal Uyghur individuals, 48 obese individuals, and 48 diabetic individuals were collected. There were 24 individual serum samples; 24 normal Kazakh individuals, 48 obese individuals, and 10 diabetic individuals; 21 normal Han individuals, 22 obese individ...
Embodiment 2
[0070] Example 2miR-X is strongly associated with obesity and type 2 diabetes
[0071] 1. miR-X is significantly overexpressed in obese and type 2 diabetic individuals
[0072] The copy number of microRNA-X (AAAGGUAAUUGUGGUUUCUGC) was verified in the serum of 24 normal, 48 obese and 24 T2DM Uyghur individuals and 24 normal, 48 obese and 10 T2DM Kazakh individuals. In contrast, the copy number of this sequence was significantly increased in the obesity group and the T2DM group (P<0.05), suggesting that microRNA-X (AAAGGUAAUUGUGGUUUCUGC) may be closely related to the occurrence and development of type 2 diabetes.
[0073] 2. The expression of miR-X was significantly positively correlated with glucose and lipid metabolism
[0074] SPSS 25.0 was used to analyze the correlation between miR-X and glucose and lipid metabolism-related indicators. The results of Spearman correlation analysis showed that miR-X was significantly correlated with BMI, fasting blood glucose, TG, TC, LDL an...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com