Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

microRNA sequence for early diagnosis of type 2 diabetes and application of microRNA sequence

A technology for early diagnosis of type 2 diabetes, applied in the field of medicine, can solve problems such as unclear mechanism and achieve accurate diagnosis

Pending Publication Date: 2020-04-28
SHIHEZI UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recent literature has shown that obesity can cause T2DM, but the specific mechanism is not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • microRNA sequence for early diagnosis of type 2 diabetes and application of microRNA sequence
  • microRNA sequence for early diagnosis of type 2 diabetes and application of microRNA sequence
  • microRNA sequence for early diagnosis of type 2 diabetes and application of microRNA sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] 1. The research group collected serum of 562 Uyghur individuals and analyzed it using Illumina Infinium GlobalScreening Array-24 v1.0 (GSA) Bead Chip technology, and found a microRNA sequence that was significantly positively correlated with fasting blood glucose. After database comparison, the sequence was determined to be microRNA-X, the sequence of the microRNA is AAAGGUAAUUGUGGUUUCUGC. The primers designed by the research group are as follows:

[0018] F:5'-AAAGGUAAUUGUGGUUUCUGC-3'

[0019] R: 5'-AGAAACCACAAUUACCUUUUU-3'

[0020] 2. Human sample collection:

[0021] (1) Sample grouping and source: From December 2016 to December 2018, in Kashgar, Ili and Shihezi areas of Xinjiang Uygur Autonomous Region, 24 normal Uyghur individuals, 48 ​​obese individuals, and 48 diabetic individuals were collected. There were 24 individual serum samples; 24 normal Kazakh individuals, 48 ​​obese individuals, and 10 diabetic individuals; 21 normal Han individuals, 22 obese individ...

Embodiment 2

[0070] Example 2miR-X is strongly associated with obesity and type 2 diabetes

[0071] 1. miR-X is significantly overexpressed in obese and type 2 diabetic individuals

[0072] The copy number of microRNA-X (AAAGGUAAUUGUGGUUUCUGC) was verified in the serum of 24 normal, 48 obese and 24 T2DM Uyghur individuals and 24 normal, 48 obese and 10 T2DM Kazakh individuals. In contrast, the copy number of this sequence was significantly increased in the obesity group and the T2DM group (P<0.05), suggesting that microRNA-X (AAAGGUAAUUGUGGUUUCUGC) may be closely related to the occurrence and development of type 2 diabetes.

[0073] 2. The expression of miR-X was significantly positively correlated with glucose and lipid metabolism

[0074] SPSS 25.0 was used to analyze the correlation between miR-X and glucose and lipid metabolism-related indicators. The results of Spearman correlation analysis showed that miR-X was significantly correlated with BMI, fasting blood glucose, TG, TC, LDL an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microRNA sequence for early diagnosis of type 2 diabetes and an application of the microRNA sequence, and belongs to the technical field of medicine. The sequence is microRNA-X, the microRNA sequence is shown as SEQ:ID:NO:1, and the sequence of a design primer is shown as SEQ:ID:NO:2-SEQ:ID:NO:3. According to the invention, serum of 562 Uyghur individuals is collected, analysis is performed by using an Illumina Infinium Global Screening Array-24 v1.0 (GSA) Bead Chip technology, and the microRNA sequence significantly positively correlated with fasting blood glucose isfound.

Description

technical field [0001] The invention belongs to the technical field of medicine, and relates to a microRNA sequence for early diagnosis of type 2 diabetes and its application. Background technique [0002] The incidence of type 2 diabetes (T2DM) has been increasing year by year in the world in recent years, becoming the fifth leading cause of death in the world. According to the prediction of the World Health Organization (WHO), by 2025, there will be 300 million people with diabetes in the world, of which 230 million will be in developing countries. The findings of Ning G et al. show that the current prevalence of T2DM in Chinese adults is 11.6%, and 50.1% of the adult population is in the state of prediabetes. Epidemiological data show that 80% of T2DM patients are associated with obesity, and obesity has become an important risk factor for IR and T2DM. Recent studies have shown that in the Chinese adult population, the male obesity rate increased from 0.33% in 1980 to 5...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/113
CPCC12Q1/6883C12Q2600/178C12Q2600/158
Inventor 王翠喆张雪婷张君谢建新
Owner SHIHEZI UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com