Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of ARHGEF19 antisense nucleotide sequence in preparation of drug for inhibiting tumor cell growth and expression vector of ARHGEF19 antisense nucleotide sequence

An antisense nucleotide, tumor cell technology, applied in the field of inhibiting tumor cell growth, can solve problems such as reducing ARHGEF19 expression

Active Publication Date: 2020-05-01
SUN YAT SEN UNIV CANCER CENT
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide an application of ARHGEF19 antisense nucleotide sequence in the preparation of drugs for inhibiting tumor cell growth, and to provide a targeted treatment strategy for the current poor treatment effect of small cell lung cancer. Nucleotide sequence reduces the expression of ARHGEF19, thereby inhibiting the growth of small cell lung cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ARHGEF19 antisense nucleotide sequence in preparation of drug for inhibiting tumor cell growth and expression vector of ARHGEF19 antisense nucleotide sequence
  • Application of ARHGEF19 antisense nucleotide sequence in preparation of drug for inhibiting tumor cell growth and expression vector of ARHGEF19 antisense nucleotide sequence
  • Application of ARHGEF19 antisense nucleotide sequence in preparation of drug for inhibiting tumor cell growth and expression vector of ARHGEF19 antisense nucleotide sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1. Construction of pLKO.1-ARHGEF19-shRNA lentiviral vector

[0032] (1) Synthesize the following positive and negative oligonucleotide sequences (oligos, 5'→3') containing the antisense nucleotide sequence of ARHGEF19:

[0033] ARHGEF19-shRNA-1-Forward:

[0034] CCGGGCCCAGTGTGTCTGGACCTTTCTCGAGAAAGGTCCAGACACACTGGGCTTTTTG (as shown in SEQ ID NO.3);

[0035] ARHGEF19-shRNA-1-Reverse:

[0036] AATTCAAAAAGCCCAGTGTGTCTGGACCTTTCTCGAGAAAGGTCCAGACACACTGGGC (as shown in SEQ ID NO.4);

[0037] ARHGEF19-shRNA-2-Forward:

[0038] CCGGCCAGTCTCGATTCCTCCTTAACTCGAGTTAAGGAGGAATCGAGACTGGTTTTTG (as shown in SEQ ID NO.5);

[0039] ARHGEF19-shRNA-2-Reverse:

[0040] AATTCAAAAAACCAGTCTCGATTCCTCCTTAACTCGAGTTAAGGAGGAATCGAGACTGG (as shown in SEQ ID NO.6);

[0041] At the same time, the following two oligonucleotide sequences (5' → 3') of the pros and cons of the disordered sequence without any corresponding sequence on the genome were synthesized as a control:

[0042] Scramble-sh...

Embodiment 2

[0062] Example 2. Construction of small cell lung cancer cells that stably knock down ARHGEF19

[0063] (1) Packaging of lentivirus

[0064] First, HEK293T cells were divided into 5 × 10 per well 5 Cells were plated in a six-well plate and cultured overnight; the next day, when the cell density was 60-70%, transfection was performed, and the ratio of transfection plasmid was pLKO.1 vector: psPAX.2: pMD2.G=4:3: 1. The transfection process follows Lipofectin TM 2000 Transfection Reagent Manual; 8 hours after transfection, fresh medium was replaced, and the supernatant was collected 48 hours after the medium change, which was the lentivirus solution.

[0065] (2) Screening of lentivirus-infected small cell lung cancer cells and stable cell lines

[0066] Infect the small cell lung cancer cell lines NCI-H69 and NCI-H526 cells with the packaged lentivirus solution, add puromycin (Puromycin) for stable selection after 48 hours of infection, and select for about 5 days, so that al...

Embodiment 3

[0075] Example 3. The effect of ARHGEF19 knockdown on the growth of small cell lung cancer cells

[0076] Count the cells verified above, and dilute the cells to 1×10 5 cells / ml, inoculated in a six-well plate, inoculated 1ml per well, that is, 1×10 5 cells / well, each group of cells was inoculated into 7 wells, and placed in the incubator to continue culturing. The next day, the cells in one well of each group were counted for three times each time, and the average value was taken as the number of cells in the group. Continue to count, count the number of cells in each group for 7 days in total. Repeat three times, take time (days) as the horizontal axis, and the number of cells per day as the vertical axis, draw the cell growth curve, and use SPSS software for statistical analysis. Figure 8 and Figure 9 The growth curves of NCI-H69 and NCI-H526 cells after knocking down ARHGEF19, respectively, show that after shRNA inhibits the expression of ARHGEF19, the proliferation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of an ARHGEF19 antisense nucleotide sequence in preparation of a drug for inhibiting tumor cell growth. The target sequence of the ARHGEF19 antisense nucleotide sequence is a sequence which is positioned on ARHGEF19 and is shown as SEQ ID NO.1 or SEQ ID NO.2. A positive sequence and a negative sequence of the ARHGEF19 antisense nucleotide sequence are respectively as shown in SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.5 or SEQ ID NO.6. The invention also discloses a preparation method of the ARHGEF19 antisense nucleotide sequence. The invention also providesan expression vector of the ARHGEF19 antisense nucleotide sequence. Aiming at a condition that the existing small cell lung cancer treatment effect is poor, the invention provides a targeted treatmentstrategy, and the expression of ARHGEF19 is reduced through the antisense nucleotide sequence of the ARHGEF19, so that the growth of small cell lung cancer cells is inhibited.

Description

technical field [0001] The invention relates to the technical field of inhibiting tumor cell growth, in particular to the application of an ARHGEF19 antisense nucleotide sequence in the preparation of tumor cell growth inhibiting drugs and its expression vector. Background technique [0002] ARHGEF19 (Rho guanine nucleotide exchange factor 19, also known as WGEF) belongs to the Rho guanylate exchange factor (RhoGEFs, also known as ARHGEFs) family, RhoGEFs protein can activate Rho by catalyzing Rho-GDP to Rho-GTP, thereby activating Rho Rho protein is involved in various signal transduction pathways in cells, and plays an important role in gene transcription, cell cycle, vesicle transport and angiogenesis. It has been reported that members of the RhoGEFs family are involved in the occurrence and development of tumors. For example, ARHGEF2 plays a role in promoting the metastasis of breast cancer, melanoma, and liver cancer, and the high expression of ARHGEF5 can promote the o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7105A61P35/00C12N15/113C12N15/85
CPCA61K31/7105A61P35/00C12N15/113C12N15/85C12N2310/11
Inventor 陈帅
Owner SUN YAT SEN UNIV CANCER CENT