Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of reagent for detecting expression level of CALM2 gene

A technology of gene expression level and reagents, applied in recombinant DNA technology, microbial determination/examination, DNA/RNA fragments, etc., can solve the problems of low early diagnosis rate, low diagnosis of bacterial-negative pulmonary tuberculosis, and difficulties in the diagnosis of bacterial-negative pulmonary tuberculosis, etc. Achieve accurate and easy-to-judge results

Active Publication Date: 2020-05-19
SOUTHERN MEDICAL UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a variety of new diagnostic techniques based on immunology, molecular biology, and enzymology have emerged, even if multiple diagnostic techniques are combined, the diagnosis of bacterial-negative pulmonary tuberculosis is still low, and the early diagnosis rate is lower. The incidence of tuberculosis and comorbidities of other diseases such as AIDS have been declining in recent years, especially the diagnosis of bacterium-negative pulmonary tuberculosis is still a major difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of reagent for detecting expression level of CALM2 gene
  • Application of reagent for detecting expression level of CALM2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] 1. Primer design

[0029] Design primers for fluorescent quantitative PCR amplification of human CALM2 gene (NCBI Reference Sequence: NM_001743):

[0030] F: AGTGCTGCAGAACTTCGCCATG (SEQ ID NO. 1);

[0031] R: CAAGGTCTTCACTTTGCTGTCATC (SEQ ID NO. 2).

[0032] 2. Test operation

[0033] 1) Isolate the peripheral blood of patients with positive tuberculosis and healthy controls, and destroy red blood cells with red blood cell lysate.

[0034] Lymphocyte separation medium was used to separate peripheral blood mononuclear cells (PBMC) from healthy volunteers; density gradient centrifugation was used to separate and purify PBMC, and the specific operations were as follows:

[0035] ① Add an appropriate amount of Ficoll lymphocyte separation medium to a 15mL graduated sterile centrifuge tube;

[0036] ②Take heparin-anticoagulated peripheral venous blood and an equal amount of RPMI 1640 solution to fully mix and dilute, use a Pasteur dropper to draw 2 times the volume of an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a reagent for detecting the expression level of a CALM2 gene in diagnosis of bacterial negative pulmonary tuberculosis. The invention designs and obtains a fluorescent quantitative PCR amplification primer F of human CALM2 gene: AGTGCTGCAGAACTTCGCCATG; and a primer r: CAAGGTCTTCACTTTGCTGTCATC. The invention achieves the technical effect of detecting the CALM2gene expression level in real time by extracting RNA of human peripheral blood leukocytes, the reagent is used for distinguishing healthy people and patients suffering from negative tuberculosis, andthe sensitivity and specificity can both reach 80% or above, so that pulmonary tuberculosis treatment and isolation measures are taken more pertinently.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a reagent for detecting the expression level of CALM2 gene in the diagnosis of bacterial negative pulmonary tuberculosis. Background technique [0002] Tuberculosis (Tuberculosis, TB) is a major infectious disease caused by Mycobacterium tuberculosis infection that seriously endangers human health. Although there are effective anti-tuberculosis drugs, tuberculosis is still the number one killer of infectious diseases due to the high rate of tuberculosis infection and serious problem of drug resistance. About 2 million people die from tuberculosis every year in the world, and the prevention and control situation is very grim. Early diagnosis of active tuberculosis patients is not only the key to improving the treatment effect, but also the key to effective control of tuberculosis transmission. Sputum Mycobacterium tuberculosis microbiological examination has high sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6851C12N15/11
CPCC12Q1/6883C12Q1/6851C12Q2600/158C12Q2521/107C12Q2531/113C12Q2561/101
Inventor 马骊胡胜锋韩振玉温茜
Owner SOUTHERN MEDICAL UNIVERSITY