Simple sequence repeats (SSR) primer and method for identifying purity of hybrid seeds of Yunnan raphanus sativus L. No. 2
A hybrid seed purity, cloud radish technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as heavy workload, long cycle, false hybrids, etc., and achieve high efficiency and accurate quality. The effect of control and labeling with good repeatability and fast detection method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] This embodiment provides a SSR primer SSR06 for the purity identification of Yunluobo No. 2 hybrid seeds. The screening process is as follows:
[0047] According to the genome information of radish, 200 pairs of primers were designed to screen among the parents of Yunluobo No. 2, and the primer pair SSR06( figure 1 ), the marker has good repeatability and clear bands, and the sequence is as follows:
[0048] Upstream primer: GAAGCAGATGATTGCAAAACC (SEQ ID NO: 1)
[0049] Downstream primer: CATCCGTTTTGAAGATGGAAA (SEQ ID NO: 2).
Embodiment 2
[0051] This embodiment provides a method for identifying the purity of Yunluobo No. 2 hybrid seeds, comprising the following steps:
[0052] 1) Extraction of genomic DNA:
[0053] Soak the hybrid seeds of Yunluobo No. 2 for 12 hours, sow them in plug trays after being white, and place them in a light incubator. After germination, remove the hypocotyls and place them in a 1.5mL centrifuge tube, add liquid nitrogen and grind them with a grinding rod, add 200 μL 2% CTAB extraction buffer, grind, make up to 700 μL, and bathe in water at 65°C for 40 minutes;
[0054] Add 700 μL of chloroform and isoamyl alcohol in total, where V chloroform: V isoamyl alcohol = 24:1, shake gently for 5 min, and then centrifuge at 12000 rpm for 10 min;
[0055] Take 250 μL of supernatant, add 250 μL of pre-cooled isopropanol and mix well, place at -20°C for 30 min; centrifuge at 12,000 rpm for 10 min; discard the supernatant, add 150 μL of pre-cooled ethanol, mix gently and wash, centrifuge at 12,00...
Embodiment 3
[0071] The purity detection of Yunluobo No. 2 hybrid produced in different seed production bases
[0072] The SSR primer SSR06 was used to perform PCR detection on 100 Yunradish No. 2 radish hybrids produced by farmers in three seed production bases.
[0073] The results are shown in Table 1. The purity of No. 1 and No. 3 seed production base Yunluobo No. 2 hybrids is 100% ( image 3 , Figure 5 ); No. 2 seed production base Yunluobo No. 2 hybrid has a purity of 99%, such as Figure 4 The figure shows that one of the seeds with the paternal band type (the band shown in the triangle) is a non-hybrid, and the rest of the seeds are Yunluobo No. 2 hybrids.
[0074] Table 1 The purity detection of Yunluobo No. 2 hybrid produced in different seed production bases
[0075]
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


