Tlr7/8 antagonists and uses thereof

A technology of -CO2R and -NRSO2R, applied in the field of TLR7/8 antagonist and its application

Pending Publication Date: 2020-08-07
MERCK PATENT GMBH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although various TLR7, TLR8 and TLR9 inhibitors have been described, additional TLR inhibitors are still desired

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tlr7/8 antagonists and uses thereof
  • Tlr7/8 antagonists and uses thereof
  • Tlr7/8 antagonists and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0444] Example 1. Pharmaceutical preparations

[0445] (A) Injection vial: a solution of 100 g of the active ingredient of the present invention and 5 g of disodium hydrogen phosphate in 3 liters of double distilled water was adjusted to pH 6.5 using 2N hydrochloric acid, sterile filtered, transferred to an injection vial, and frozen under aseptic conditions. Dry and seal under sterile conditions. Each injection vial contains 5 mg of active ingredient.

[0446] (B) Suppositories: 20 g of the active ingredient of the invention are melted with a mixture of 100 g of soy lecithin and 1400 g of cocoa butter, poured into molds and allowed to cool. Each suppository contains 20 mg of active ingredient.

[0447] (C) solution: in 940ml heavy distilled water, by 1g active ingredient of the present invention, 9.38gNaH 2 PO 4 2H 2 O, 28.48gNa 2 HPO 4 12H 2 O and 0.1 g benzalkonium chloride to prepare a solution. The pH was adjusted to 6.8 and the solution was made up to 1 l and ster...

Embodiment 2

[0463] Human peripheral blood lymphocytes were transfected with let-7c and let-7e miRNAs. 24 hours after transfection, IL-6 in the cell supernatant was analyzed ( figure 1 ) and IFNα ( figure 2 ) presence of cytokines. Two forms of RNA oligonucleotides with phosphate or phosphorothioate linkages were used, respectively.

[0464] Hu let-7c UGAGGUAGUAGGUUGUAUGGUU (+ / - phosphorothioate bond)

[0465] Hu let-7e UGAGGUAGGAGGUUGUAUAGUU (+ / - phosphorothioate bond)

[0466] Alu motif B

[0467] UUUUUUUUUUUUUUUUUUUUUUUUUGAGACGGAGUCUCGCUCUGUCGCC (only diester bonds)

[0468] These findings demonstrate that delivery of let7 miRNA to human PBMCs induces IFNα and IL-6 production in a dose-dependent manner.

Embodiment 3

[0470] Human PBMC were treated with a TLR7 agonist (TLR7), let7c miRNA or transfected with let7c miRNA (let7 / DOTAP) in the presence of a TLR7 / 8 antagonist (compound 467 in Table 1 above). After overnight incubation, IL-6 ( image 3 ) and IFNα ( Figure 4 )s level.

[0471] These findings demonstrate that small-molecule TLR7 / 8 antagonists block let-7 miRNA-induced cytokine production in human PBMCs.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides for the treatment of disorders related to TLR7 / 8 overexpression or abherrant activation, wherein the disorder is selected from multiple sclerosis, Alzheimer's Disease, myositis, stroke, ischemia, CNS neuropathies, systemic lupus erythematosus, lupus nephritis, Sjogren's syndrome, Guillain-Barr syndrome, alcoholic hepatitis, non-alcoholic steatohepatitis, congenital heart block, autoimmune hepatitis, autoimmune pancreatitis, adult onset Still's disease, drug-induced neurological disorders, and substance addiction, using a compound of Formula (I).

Description

[0001] technical field of invention [0002] The present invention provides the use of compounds of formula (I) for the treatment of disorders associated with overexpression of TLR7 / 8 or abnormal activity of TLR7 / 8, such as multiple sclerosis, Alzheimer's disease, myositis, stroke, ischemia, CNS neuropathy , systemic lupus erythematosus, lupus nephritis, Sjogren's syndrome, Guillain-Barré syndrome, alcoholic hepatitis, nonalcoholic steatohepatitis, congenital heart block, autoimmune hepatitis, autoimmune pancreatitis, Still's disease, drug-induced neurologic disorders, and substance addiction in adults. [0003] Background of the invention [0004] Toll-like receptors (TLRs), currently comprising a gene family of 10 receptors with different specificities, are part of the pattern recognition system of cellular pathogens that have evolved to defend against a variety of infections (bacteria, viruses, fungi). Activation of TLRs leads to cytokine responses, such as the release of i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07D401/14C07D405/14C07D413/14C07D215/12C07D215/18C07D401/04C07D413/04C07D417/04C07D241/42C07D471/04C07D487/04A61P37/00A61K31/4545
CPCC07D401/14C07D405/14C07D413/14C07D215/12C07D215/18C07D401/04C07D413/04C07D417/04C07D241/42C07D471/04C07D487/04A61P37/00Y02A50/30A61K31/4545A61K31/519A61K31/4985A61K31/5377A61P25/28A61K31/4709A61K31/498A61K31/551
InventorB.A.舍雷尔J.夫拉赫
OwnerMERCK PATENT GMBH