Closed sequence, capture kit, library hybridization capture method and library building method

A technology of blocking sequences and capturing reagents, applied in the field of high-throughput sequencing library construction, can solve problems such as sample label hopping, and achieve the effect of increasing the blocking effect and enhancing the binding ability.

Active Publication Date: 2020-10-09
NANODIGMBIO (NANJING) BIOTECHNOLOGY CO LTD
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The main purpose of the present invention is to provide a closed sequence, a capture kit, a library hybridization capture method, and a library construction method to solve the problem of subsequent sample label jumping in the library constructed in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Closed sequence, capture kit, library hybridization capture method and library building method
  • Closed sequence, capture kit, library hybridization capture method and library building method
  • Closed sequence, capture kit, library hybridization capture method and library building method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Single and double screening in the process of building a database in embodiment 1

[0069] Method 1: Single selection of fragments (recommended for gDNA / FFPE DNA samples)

[0070] 1. Put NanoPrep in advance TM The SP magnetic beads were taken out, vortexed and mixed, and used after equilibrating at room temperature for 30 minutes.

[0071] 2. According to the following table, add V1 (see Table 1-1) volume NanoPrep to the PCR tube of the connection system after the adapter connection is completed. TM SP magnetic beads, mix well, and incubate at 25°C for 5-10min.

[0072] Table 1-1:

[0073] Add DNA (after fragmentation) NanoPrep TM SP magnetic beads dosage (V1)

≥50ng 40μl 30μl

[0074] 3. Centrifuge the PCR tube briefly and place it on the magnetic stand for 5 minutes until the liquid is completely clear, then use a pipette to remove the supernatant.

[0075] 4. Slowly add 150 μl of 80% ethanol along the side wall of the PCR tub...

Embodiment 2

[0125] Using the aforementioned NanoPrep TM The construction steps in the DNA library construction kit, wherein the steps of hybridization and capture are carried out as follows:

[0126] When performing multi-library hybrid hybridization capture after vacuum concentration, the specific hybridization library mixing steps are as follows in Table 2-1:

[0127] table 2-1:

[0128]

[0129]

[0130] 1) comparison A --- one-to-one closure in the prior art

[0131] 1.1p5 end one-to-one blocking sequence (SEQ ID NO: 6)

[0132] AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT GCGCATAT GTGTAGATCTCGGTGGTCGCCGTATCATT

[0133] 1. One-to-one blocking sequence of 2p7 end (SEQ ID NO: 7)

[0134] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC CTGATCGT ATCTCGTATGCCGTCTTCTGCTTG

[0135] Note: The bold and underlined part is the tag sequence, which is different for different closed sequences. This example uses the udi linker of IDT and the corresponding closed sequence.

[0136] 2) Control B---segmented ...

Embodiment 3

[0216] Factors affecting the blocking effect In addition to the modification of the blocking sequence described in Example 2 to improve the binding ability of the blocking sequence and the blocked sequence, the number of molecules in the blocking sequence and the blocked library can be further improved. The procedure for building a library and hybridization experiment is the same as in Examples 1 and 2. In this embodiment, the closed sequences shown in SEQ ID NO: 1 and SEQ ID No: 2 are used to perform the following hybrid capture sequencing respectively. The library and closed sequence ratios are shown in Table 3- 1.

[0217] Table 3-1: Library and closed sequence mix

[0218]

[0219] Note: 1500ng library, 400bp length is equivalent to 6pmol molecules.

[0220] Sequencing after capture, the capture efficiency is better when the closed sequence molecule and the library molecule are greater than 20:1, and the capture efficiency is relatively low when it is less than 20:1, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a closed sequence, a capture kit, a library hybridization capture method and a library building method. Wherein the closed sequence comprises a first closed segment and a secondclosed segment in the direction from 5'to 3', the second closed segment is arranged at the downstream of the first closed segment, and the 3' ends of the first closed segment and the second closed segment are provided with closed modifications; and part of basic groups on the first closed section and the second closed section are LNA or BNA modified basic groups. LNA or BNA modification is carried out on part of basic groups on the first closed segment and the second closed segment, so that the binding capacity of a to-be-closed sequence can be enhanced, and the closing effect is improved; the 3'ends of the first closed segment and the second closed segment are subjected to closed modification, so that redundant joints in the library cannot be used as primers to amplify the joints of other libraries, and the improvements in the two aspects enable the closed sequence disclosed by the invention to reduce or avoid unnecessary amplification of the redundant joints in the library and sample label skipping phenomena.

Description

technical field [0001] The invention relates to the field of high-throughput sequencing library construction, in particular to a closed sequence, a capture kit, a library hybrid capture method and a library construction method. Background technique [0002] With the emphasis and strong demand for accurate diagnosis of high-throughput sequencing in the market, high-throughput sequencers need to continuously improve the sequencing throughput to meet the growing sequencing demand. In order to meet the above needs, Illumina has upgraded HiSeq3000 / 4000. The updated sequencer has a huge increase in sequencing throughput compared with the previous version. [0003] In order to improve the throughput of sequencing output, the above-mentioned sequencing platforms adopt two new technologies, Patterned Flow Cell Technology (PFCT) chip and Exclusive Amplification (ExAmp) clustering. The throughput of the new version of the sequencer is higher, and more samples can be mixed in a single ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/6874C40B50/06
CPCC12Q1/6874C40B50/06C12Q2535/122C12Q2525/191C12Q2563/143
Inventor胡玉刚曲燕汪彪唐守运郑文莉吴强
OwnerNANODIGMBIO (NANJING) BIOTECHNOLOGY CO LTD