Closed sequence, capture kit, library hybridization capture method and library building method
A technology of blocking sequences and capturing reagents, applied in the field of high-throughput sequencing library construction, can solve problems such as sample label hopping, and achieve the effect of increasing the blocking effect and enhancing the binding ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Single and double screening in the process of building a database in embodiment 1
[0069] Method 1: Single selection of fragments (recommended for gDNA / FFPE DNA samples)
[0070] 1. Put NanoPrep in advance TM The SP magnetic beads were taken out, vortexed and mixed, and used after equilibrating at room temperature for 30 minutes.
[0071] 2. According to the following table, add V1 (see Table 1-1) volume NanoPrep to the PCR tube of the connection system after the adapter connection is completed. TM SP magnetic beads, mix well, and incubate at 25°C for 5-10min.
[0072] Table 1-1:
[0073] Add DNA (after fragmentation) NanoPrep TM SP magnetic beads dosage (V1)
≥50ng 40μl 30μl
[0074] 3. Centrifuge the PCR tube briefly and place it on the magnetic stand for 5 minutes until the liquid is completely clear, then use a pipette to remove the supernatant.
[0075] 4. Slowly add 150 μl of 80% ethanol along the side wall of the PCR tub...
Embodiment 2
[0125] Using the aforementioned NanoPrep TM The construction steps in the DNA library construction kit, wherein the steps of hybridization and capture are carried out as follows:
[0126] When performing multi-library hybrid hybridization capture after vacuum concentration, the specific hybridization library mixing steps are as follows in Table 2-1:
[0127] table 2-1:
[0128]
[0129]
[0130] 1) comparison A --- one-to-one closure in the prior art
[0131] 1.1p5 end one-to-one blocking sequence (SEQ ID NO: 6)
[0132] AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT GCGCATAT GTGTAGATCTCGGTGGTCGCCGTATCATT
[0133] 1. One-to-one blocking sequence of 2p7 end (SEQ ID NO: 7)
[0134] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC CTGATCGT ATCTCGTATGCCGTCTTCTGCTTG
[0135] Note: The bold and underlined part is the tag sequence, which is different for different closed sequences. This example uses the udi linker of IDT and the corresponding closed sequence.
[0136] 2) Control B---segmented ...
Embodiment 3
[0216] Factors affecting the blocking effect In addition to the modification of the blocking sequence described in Example 2 to improve the binding ability of the blocking sequence and the blocked sequence, the number of molecules in the blocking sequence and the blocked library can be further improved. The procedure for building a library and hybridization experiment is the same as in Examples 1 and 2. In this embodiment, the closed sequences shown in SEQ ID NO: 1 and SEQ ID No: 2 are used to perform the following hybrid capture sequencing respectively. The library and closed sequence ratios are shown in Table 3- 1.
[0217] Table 3-1: Library and closed sequence mix
[0218]
[0219] Note: 1500ng library, 400bp length is equivalent to 6pmol molecules.
[0220] Sequencing after capture, the capture efficiency is better when the closed sequence molecule and the library molecule are greater than 20:1, and the capture efficiency is relatively low when it is less than 20:1, t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


