Supercharge Your Innovation With Domain-Expert AI Agents!

Applications of two WRKY transcription factor genes in rice and encoded proteins thereof

A transcription factor and rice technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of poor knowledge and achieve the effect of improving absorption and accumulation capacity

Active Publication Date: 2020-11-13
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the above transcription factors are involved in signal transduction pathways under phosphorus-deficient conditions, but so far little is known about phosphorus signaling pathways in crops under phosphorus-sufficient conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of two WRKY transcription factor genes in rice and encoded proteins thereof
  • Applications of two WRKY transcription factor genes in rice and encoded proteins thereof
  • Applications of two WRKY transcription factor genes in rice and encoded proteins thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Obtaining of OsWRKY21 and OsWRKY108 Gene Coding Region Sequences

[0036] (1) Sequence information acquisition and feature analysis of OsWRKY21 and OsWRKY108

[0037] The applicant registered in NCBI ( www.ncbi.nlm.nih.gov ) obtained its cDNA sequence from the website database. The analysis showed that the full-length coding region (open reading frame, ORF) of OsWRKY21 gene was 843bp, encoding a total of 280 amino acids. OsWRKY21 contains a WRKY domain and a C2HC-type zinc finger structure (WRKYGQK-X13-CX6C-X26-HTC), which belongs to a typical Group II WRKY transcription factor. The full-length coding region of OsWRKY108 gene is 1077bp, encoding a total of 358 amino acids. OsWRKY108 contains a WRKY domain and a C2HC-type zinc finger structure (WRKYGQK-X13-CX7C-X25-HTC), which also belongs to a typical Group II WRKY transcription factor.

[0038] (2) Total RNA extraction, cDNA synthesis and molecular cloning

[0039] The selected rice is japonica rice, a...

Embodiment 2

[0041] Example 2. Using RT-qPCR technology to identify the spatiotemporal expression patterns of rice OsWKRY21 and OsWRKY108

[0042] Using the "Nipponbare" cDNA obtained in Example 1 as a template, according to the cDNA sequences of rice OsWRKY21 and OsWRKY108 genes, design specific primers in their 3' untranslated regions (3'UTR) for quantitative (RT-qPCR) analysis to identify OsWRKY21 and the spatiotemporal expression patterns of the OsWRKY108 gene. The primer sequences are as follows:

[0043] W21-3'-qRT-F:AGTCTTTGCAAAACGCACAAAA

[0044] W21-3'-qRT-R:CGCAAACGCGGGAAATT

[0045] W108-3'-qRT-F:TCAGGCGCGCATCGAT

[0046] W108-3'-qRT-R:CACCGCGACTCGTCATATGT

[0047] The specific steps of RT-qPCR are as follows: use the cDNA obtained in Example 1 as a template for RT-qPCR amplification, and use a 10 μL reaction system according to the instructions of the TaKaRa kit: SYBR PremixExTaq 5 μL, upstream and downstream primers 0.2 μL, 50×ROXReference Dye 0.2 μL, ddH 2 O 2.4 μL, dil...

Embodiment 3

[0051] Example 3 Using OsWRKY21 and OsWRKY108 promoters fused to GUS reporter gene transgenic rice plants to study the temporal and spatial expression characteristics of OsWKRY21 and OsWRKY108

[0052] (1) Construct the expression vector of promoter fusion GUS reporter gene

[0053] The rice variety "Nipponbare" was selected to extract genomic DNA for the cloning of OsWRKY21 and OsWRKY108 promoter sequences. Design PCR amplification primers with restriction sites and protective bases, as follows:

[0054] ProW21-F: TTaagcttGTCATCTTGGGATTTATGTTTG

[0055] ProW21-R:TTggtaccGCTCCTCACTCTCGCACGACA

[0056] ProW108-F:TTaagcttGCCTAGCTCGACCACCTC

[0057] ProW108-R:TTggatccGGTTCGTGTTGTTCGCTTCG

[0058] Using wild-type Nipponbare rice genomic DNA as a template, PCR amplification was performed to obtain the OsWKRY21 promoter fragment (2519bp) and the OsWRKY108 promoter sequence fragment (2582bp), which were recovered by gel electrophoresis and cloned into the cloning vector pEasy-Blu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses two WRKY transcription factor genes in rice and an application research of encoded proteins of the two WRKY transcription factor genes, and shows that OsWRKY21 and OsWKRY108 genes play a role under a phosphorus-rich condition, and the encoded proteins can be combined with a rice phosphate transport protein gene OsPHT1 1 promoter, then OsPHT1:1 transcription level is regulated and controlled, so that the absorption and accumulation of phosphorus in rice and maintains can be promoted, and the steady state of phosphorus in rice is kept. Under a phosphorus-rich condition, the accumulation of phosphorus in pht1:1 and wrky21, wrky108 mutants nutritional organs and grains is reduced. Therefore, the invention provides a method for cultivating a rice variety with reduced phosphorus luxury absorption under a phosphorus-rich condition by utilizing OsWKRY21 and OsWKRY108.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering and discloses the application of two WRKY transcription factor genes in rice. Background technique [0002] Phosphorus (P) is one of the macronutrients essential for plant growth and development. Since phosphorus is easily fixed and precipitated in soil, its concentration in soil solution is usually only 1-10 μM. Phosphorus deficiency often becomes one of the main limiting factors for plant growth in farmland and natural ecosystems (Raghothama, 1999). Therefore, the application of phosphorus fertilizer is inseparable from the high yield and quality of crops. However, the seasonal utilization efficiency of phosphorus fertilizer in my country is only about 10-20%, and the continuous application of phosphorus fertilizer throughout the year makes the soil a potential phosphorus pool. According to measurements, the available phosphorus content of my country's farmland soil has incre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/29A01H5/00A01H5/10A01H6/46
CPCC12N15/8243C07K14/415
Inventor 徐国华顾冕张骏
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More