Application of CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology in treatment of thalassemia

A base and methylation technology, applied in the field of gene editing, can solve the problems of low efficiency of plasmid delivery system, inability to achieve Cas9/sgRNA, and inability of lentivirus infection to achieve editing efficiency.

Pending Publication Date: 2020-12-01
EAST CHINA NORMAL UNIV +1
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The use of plasmids to deliver Cas9 / sgRNA is not yet clinically possible
First of all, the efficiency of the plasmid delivery system is very low, but the toxicity is relatively high. It is temporarily impossible to meet sufficient editing efficiency for later transplantation to achieve therapeutic purposes.
Using lentivirus to infect hematopoietic stem cells is a common way to deliver Cas9 / sgRNA, but it takes a long time to infect (more than 72 hours) to achieve a relatively high efficiency; Integrated carcinogenic risk, after a long period of in vitro infection, those long-term hematopoietic stem cells that really play a role in self-renewal in transplantation begin to differentiate, and their stemness is weakened, which has a great impact on the success rate of stem cell transplantation in the later stage; in addition, lentivirus Infection still cannot achieve editing efficiency above 80%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology in treatment of thalassemia
  • Application of CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology in treatment of thalassemia
  • Application of CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology in treatment of thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Design of sgRNA and Verification of Editing Efficiency

[0039] In this example, the complex of Cas9 and sgRNA was introduced into human hematopoietic stem cells by electroporation. The amino acid sequence of Cas9 is shown in SEQ ID No.5. The method flow is as follows figure 1 shown. Specifically, such as Figure 2-3 As shown, Cas9 and sgRNA can form a complex by in vitro incubation, and after electroporation into hematopoietic stem cells, they can target the upstream elements of the HBG1 gene for cleavage to up-regulate the expression of HBG.

[0040] In this embodiment, two sgRNAs are designed, sg-HBG1 and sg-HBG2, the targeting sequence of sg-HBG1 is CTTGTCAAGGCTATTGGTCA, and the targeting sequence of sg-HBG2 is CTTGACCAATAGCCTTGACA. Two chemically modified and unmodified sgRNAs were synthesized in vitro. Here, the chemical modification refers to the 1st, 1-2 or 1-3 base at the 5' end of the sgRNA targeting sequence, and / or the 1st, 1-2 or 3' base at th...

Embodiment 2

[0043] Example 2 Editing of the HBG promoter site in human hematopoietic stem cells

[0044] In this embodiment, a Cas9 and sgRNA complex is used to introduce the complex in human hematopoietic stem cells by electroporation, the amino acid sequence of the Cas9 is shown in SEQ ID No.5; the sgRNA sequence includes a targeting sequence and a backbone 序列,所述靶向序列为5'CTTGTCAAGGCTATTGGTCA3'(SEQ ID No.1),所述骨架序列为5'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC3'(SEQ ID No.2);所述sgRNA序列为5'CTTGTCAAGGCTATTGGTCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC3'(SEQ ID No .3).

[0045] In this embodiment, the 1-3 bases at the 5' end and the 1-3 bases at the 3' end of the sgRNA (SEQ ID No.3) are methylated; in other embodiments, It is also possible to carry out methylation modification or any other chemical modification at the 1-5th base at the 5' end of the sgRNA or at any one or any number of bases at the 1-5th base at the 3' end, such...

Embodiment 3

[0050] Example 3 Detection of HBG expression after gene editing

[0051] The cells of the experimental group and the control group were cultured in differentiation medium 1 (stemspan containing: 10% FBS, IL-3: 10ng / ml, SCF: 50ng / ml, EPO: 1U / ml) for 7 days, and then centrifuged at 300g for 10 minutes Seed to pellet cells, change into differentiation medium 2 (stemspan containing 30% FBS, EPO: 3U / ml) and culture for 2 days. Cells were centrifuged at 300g. Total mRNA was extracted and reverse-transcribed to obtain cDNA.

[0052] Use HBG gene forward primer 5'GATGCCATAAAGCACCTGGATG3', reverse primer 5'TTGCAGAATAAAGCCTATCCTTGA3' for QPCR amplification of HBG mRNA, use HBB gene forward primer 5'TCAAGGGCACCTTTGCCACAC3' reverse primer 5'TGATAGGCAGCCTGCACTG3' for QPCR detection of HBG mRNA relative to The expression level of HBB gene. Such as Figure 7 As shown, after editing, the content of HBG mRNA relative to HBB was significantly increased in the experimental group.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology in treatment of thalassemia. A CRISPR system in the application comprises at least one nuclease and at least one sgRNA, the sgRNA can target an inhibiting element of an HBG (gamma globin gene) promoter; the nuclease can cut the inhibiting element of the HBG promoter, the sgRNA comprises a targeting sequence targeting the inhibiting element of the HBG promoter, and the targeting sequence comprises a sequence as shown in SEQ ID No.1 or a complementary sequence as shown in SEQ ID No.1. Transferring a compound of the nuclease and the sgRNA into a cell by an electrotransformation method can knock out the inhibiting element on the HBG (gamma globin gene) promoter, and the relative content of HBG mRNA in cells is improved, and compared with a traditional lentiviral infection technology, exogenous DNA random integration caused by viruses is avoided, and the prospect of clinical application is improved.

Description

technical field [0001] This application relates to the field of gene editing technology, in particular to the application of CRISPR gene editing technology in the treatment of thalassemia. Background technique [0002] β-thalassemia is a blood genetic disease caused by mutations in the β-globin gene. Currently, there are more than 300 known pathogenic mutations in this gene. Human hemoglobin is a heterotetramer composed of α and β globins. When β-globin is mutated and unable to express or lack of function, it will cause excessive accumulation of α-globin in red blood cells, resulting in abnormal formation of red blood cells and premature apoptosis of their precursors. So patients with beta thalassemia must have constant blood transfusions to maintain the beta globin levels in the body so that red blood cells can form normally. [0003] Long-term blood transfusion will lead to excessive accumulation of iron in the body, resulting in iron poisoning, so patients must receive ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22C12N15/113A61K48/00A61P7/06
CPCC12N15/907C12N9/22C12N15/113C07K14/805A61K48/00A61P7/06C12N2310/20C12N2320/32
Inventor王立人李大力吴宇轩刘明耀席在喜
OwnerEAST CHINA NORMAL UNIV