Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitation PCR detection primer and kit for Sf-rhabdovirus

A detection kit, fluorescence quantitative technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of high cost, cumbersome sample preparation, low detection sensitivity, etc. Strong performance, good quantitative effect and good specificity

Pending Publication Date: 2020-12-11
SOUTH CHINA UNITED VACCINE INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The methods for detecting the virus include conventional ordinary PCR and electron microscope observation, etc., but the detection sensitivity is not high, and the specimen preparation is cumbersome and costly.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitation PCR detection primer and kit for Sf-rhabdovirus
  • Fluorescent quantitation PCR detection primer and kit for Sf-rhabdovirus
  • Fluorescent quantitation PCR detection primer and kit for Sf-rhabdovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Design and screening of primers

[0042] The Sf rhabdovirus belongs to the Rhabdoviridae family (Rhabdoviridae), and is a negative-strand RNA virus. Its particles are bullet-shaped or rod-shaped, and the full-length gene is 13534-bp. Design specific primer sequences for the conserved L-protein coding region of Rhabdovirus, and the GenBank accession No. on NCBI is KF947078.

[0043] 1) Design of primers

[0044] Sf rhabdovirus belongs to the Rhabdoviridae family (Rhabdoviridae), which is a negative-strand RNA virus. Its particles are bullet-shaped or rod-shaped. The full-length gene is 13534-bp. The GenBank accession No. on NCBI is KF947078.

[0045] Through the analysis of the L protein coding region of the rhabdovirus in insect cells, the rhabdovirus primer sequence was designed:

[0046] RhF1: CCCCGGAAGAATATGCCCTC (SEQ ID NO. 1);

[0047] RhR1: GCCACTGCAGAGTACAGGTT (SEQ ID NO. 2);

[0048] RhvF1: GCAAGGCTGTTTGGATTACTGAC (SEQ ID NO. 3);

[0049] RhvR1: CAG...

Embodiment 2

[0076] The fluorescent quantitative PCR detection method of embodiment 2 Sf rhabdovirus

[0077] A fluorescent quantitative PCR detection method for Sf rhabdovirus, comprising the following steps:

[0078] S1. Extract RNA from the sample;

[0079] S2. Reverse transcribe the RNA to obtain cDNA;

[0080] S3. Using cDNA as a template and using primers to perform fluorescent quantitative PCR detection;

[0081] S4. Analyzing the Ct value of the test result to determine whether the sample contains Rhabdovirus.

[0082] The RT-PCR amplification reaction system is: 10 μL of TB Green Fast qPCR Mix (2X); 0.4 μL of 50×ROXReference Dye II; 0.4 μL of RhF1 primer (10 μmol / L); 0.4 μL of RhR1 primer (10 μmol / L) ; 2 μL of cDNA template; add ddH2O to make up volume to 20 μL.

[0083] RT-PCR amplification reaction program: 95°C pre-denaturation for 2 minutes, 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles, end. Dissolving program: 95°C for 15 seconds, 60°C for 30 seconds, from 60°C to ...

Embodiment 3

[0090] Fluorescent quantitative PCR sensitivity test of embodiment 3 Sf rhabdovirus

[0091] The plasmid containing the rhabdovirus sequence-positive clone prepared in Example 1 was diluted to 8 concentrations, and the corresponding copy number was 8E*10-10 copy number. According to the fluorescent quantitative PCR detection method in Example 2, the positive clone plasmids with gradient concentrations were detected, and the RhF1 / R1 primer pair with the best sensitivity and specificity was selected, and the amplification curve was as attached. Figure 5 As shown, the dissolution curve is shown in the attached Figure 6 As shown, the standard curve is attached Figure 7 shown.

[0092] Figure 5 Among them, A: 10 copy number; B: 100 copy number; C: 3E*10 copy number; D: 4E*10 copy number; E: 5E*10 copy number; F: 6E*10 copy number; G: 7E* 10 copy number; H:8E*10 copy number.

[0093] From attached Figure 5 It can be seen that the plasmids of each copy number of A-H have g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitation PCR detection primer and kit for a Sf-rhabdovirus. The nucleotide sequence of the fluorescent quantitation PCR primer is disclosed by SEQ ID NO.1-SEQID NO.2. The fluorescent quantitation PCR primer disclosed by the invention can specifically detect the Sf-rhabdovirus, is high in detection sensitivity, has an extremely good linear relationship ina copy range of 8E*10-10, efficiently detects the Sf-rhabdovirus and improves detection efficiency.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and more specifically relates to a fluorescent quantitative PCR detection primer and a kit for Sf rhabdovirus. Background technique [0002] Insect cell Sf9 cell is a cell line isolated from Spodoptera frugiperda. This cell line is often used in the production of recombinant proteins and vaccines. For a long time, research institutions and companies believe that this cell has no rhabdovirus pollute. In 2014, researchers at the U.S. Food and Drug Administration (FDA) discovered that a previously undiscovered Sf rhabdovirus (Sf-rhabdovirus) was lurking in the Sf9 cell line. The researchers discovered the virus through PCR and massively parallel sequencing experiments, while observing the rhabdovirus-like particles through electron microscopy. [0003] Currently, there is a need to demonstrate the presence of Sf rhabdoviruses in cell lines and products used in the production of biological ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/701C12Q1/6851C12Q2600/166C12Q2531/113C12Q2563/107C12Q2545/113C12Q2545/101C12Q2521/107
Inventor 彭涛黄志球苏文瀚许煜华
Owner SOUTH CHINA UNITED VACCINE INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com