Eriocheir Sinensis male specific Etse gene and application thereof
A Chinese mitten crab, male technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of reporting and not clarifying the sex determination mechanism of Chinese mitten crab
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The present embodiment provides the method for amplifying the male-specific Etse gene of Chinese mitten crab, comprising the following steps:
[0051] An upstream primer and a downstream primer were synthesized by a biological company, and the sequences of the upstream and downstream primers were ATGGTCCGTGTTCAATGGCC (as shown in SEQ ID NO: 3) and TCAAGCGGCGCAGTCTGA (as shown in SEQ ID NO: 4).
[0052] The testes of healthy and mature male crabs of Eriocheir sinensis were dissected, and the total RNA of the testis was extracted by Trizol reagent, and the genomic DNA was removed by DNase treatment.
[0053] Take 1 μg of the above-mentioned total RNA sample of the mitten crab testis, mix it with Oligo dT and related reverse transcription reagents, perform reverse transcription, obtain cDNA, and store it at -20°C for future use.
[0054] Using the above cDNA as a template and the primers synthesized in step 1 as amplification primers, high-fidelity Taq enzyme was used for ...
Embodiment 2
[0059] The present embodiment provides the method for sex identification based on the male-specific Etse gene of Chinese mitten crab, comprising the following steps:
[0060] Primers were designed according to the nucleotide sequence of the above-mentioned Etse gene, the upstream primer sequence was ACGCCGAGGAAGACAAAGGTG (as shown in SEQ ID NO: 5), and the downstream primer sequence was TCCGGTTCCTCCGGTCTCAG (as shown in SEQ ID NO: 6).
[0061] Chinese mitten crab cDNA sample preparation:
[0062] Six mature male and female Eriocheir sinensis were dissected to obtain their gonads respectively. RNA was extracted by conventional Trizol method and reverse transcribed into cDNA.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com