Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Eriocheir Sinensis male specific Etse gene and application thereof

A Chinese mitten crab, male technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of reporting and not clarifying the sex determination mechanism of Chinese mitten crab

Pending Publication Date: 2021-01-22
SHANGHAI OCEAN UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sex-determining genes of Chinese mitten crab are still unknown, and there is still no clear report on the sex-determining mechanism of Chinese mitten crab. Therefore, it is necessary to obtain a molecular marker of a sex-specific gene of Chinese mitten crab

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eriocheir Sinensis male specific Etse gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The present embodiment provides the method for amplifying the male-specific Etse gene of Chinese mitten crab, comprising the following steps:

[0051] An upstream primer and a downstream primer were synthesized by a biological company, and the sequences of the upstream and downstream primers were ATGGTCCGTGTTCAATGGCC (as shown in SEQ ID NO: 3) and TCAAGCGGCGCAGTCTGA (as shown in SEQ ID NO: 4).

[0052] The testes of healthy and mature male crabs of Eriocheir sinensis were dissected, and the total RNA of the testis was extracted by Trizol reagent, and the genomic DNA was removed by DNase treatment.

[0053] Take 1 μg of the above-mentioned total RNA sample of the mitten crab testis, mix it with Oligo dT and related reverse transcription reagents, perform reverse transcription, obtain cDNA, and store it at -20°C for future use.

[0054] Using the above cDNA as a template and the primers synthesized in step 1 as amplification primers, high-fidelity Taq enzyme was used for ...

Embodiment 2

[0059] The present embodiment provides the method for sex identification based on the male-specific Etse gene of Chinese mitten crab, comprising the following steps:

[0060] Primers were designed according to the nucleotide sequence of the above-mentioned Etse gene, the upstream primer sequence was ACGCCGAGGAAGACAAAGGTG (as shown in SEQ ID NO: 5), and the downstream primer sequence was TCCGGTTCCTCCGGTCTCAG (as shown in SEQ ID NO: 6).

[0061] Chinese mitten crab cDNA sample preparation:

[0062] Six mature male and female Eriocheir sinensis were dissected to obtain their gonads respectively. RNA was extracted by conventional Trizol method and reverse transcribed into cDNA.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Eriocheir Sinensis male specific Etse gene and application thereof. The nucleotide sequence of the Eriocheir Sinensis male specific Etse gene is shown as SEQ ID NO: 1, the amino acid sequence of encoded protein is shown as SEQ ID NO: 2, male specific molecular marker primers are shown as SEQ ID NO: 5 and SEQ ID NO: 6, and the Eriocheir Sinensis male specific Etse gene, the encoded protein or the male specific molecular marker primers are used for sex identification of Eriocheir Sinensis. An identification method comprises the following steps: carrying out PCR amplification by adopting the male specific molecular marker primers, carrying out electrophoresis detection after the reaction is finished, and displaying that the Eriocheir Sinensis with a specific band ismale and the Eriocheir Sinensis without the specific band is female by virtue of an electrophoresis result. The method is simple and efficient, and the sex determination of the Eriocheir Sinensis canbe quickly realized at the molecular level.

Description

technical field [0001] The invention relates to the male-specific Etse gene of Chinese mitten crab and its application in sex identification, and belongs to the technical field of sex identification of Chinese mitten crab. Background technique [0002] Chinese mitten crab (Eriocheir sinensis), commonly known as river crab, belongs to Arthropoda, Crustacean, Malacostraca, Decapoda, and Grapsidae. The genus Eriocheir is widely distributed in major water systems from north to south in my country, mainly including Liaohe River, Yellow River, Yangtze River, Oujiang River, Minjiang River, Pearl River and Nanliujiang River. It is an important aquaculture object and economic crab in China. one of the classes. In 2019, the output of Chinese mitten crab farming in my country reached 779,000 tons, with an output value of about 69 billion yuan. Generally speaking, the male individual of Chinese mitten crab is larger than the female crab, and the accessory gonad after the testis matures ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435C12N15/10C12Q1/6879C12Q1/6888C12N15/11
CPCC07K14/43509C12N15/1096C12Q1/6879C12Q1/6888C12Q2531/113
Inventor 陈晓雯王军王成辉
Owner SHANGHAI OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com