IPTG-induced tRNA element in pichia pastoris as well as construction method and application thereof
A Pichia pastoris and element technology, applied in the field of IPTG-induced tRNA element in Pichia pastoris and its construction, can solve problems such as non-existence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 12
[0047] The biotin-labeled RNA probe of Example 12 was synthesized at Shanghai Jierui Bioengineering Co., Ltd., and its sequence is:
[0048] Biotin-TTCGAACCCACGaCCATCGCGTTATAAGCACGATGCGCTaaACCACTG, SEQ ID NO:25.
[0049] 3. Medium and culture conditions
[0050] LLB medium: 1% (w / v, the same below) peptone (Tryptone), 0.5% yeast powder (Yeast Extract), 0.5% sodium chloride (NaCl), add deionized water to dissolve. 2% agar powder (Agar) was added when preparing solid plates. Autoclave at 121°C for 20 minutes.
[0051] YPD medium: 2% (w / v, the same below) peptone (Tryptone), 1% yeast powder (Yeast extract), 2% glucose (Glucose), add deionized water to dissolve. 2% agar powder (Agar) was added when preparing solid plates. When preparing, glucose was separately prepared into a 50% solution, sterilized by filtration with a 0.22 μm sterile filter membrane, and stored in a refrigerator at 4°C until use. Peptone and yeast powder were prepared in proportion to a solution, and steri...
Embodiment 1
[0058] Based on the genome sequence of Pichia pastoris GS115 (Pichia pastoris GS115) in the NCBI database, all tRNA gene sequences and copy numbers were determined by the online tool tRNAscan (http: / / lowelab.ucsc.edu / tRNAscan-SE / ). In the following, the tRNA gene carrying the Ile (isoleucine) anticodon as TAT is selected as an example, that is, the expression of tRNA-Ile for further research.
Embodiment 2
[0059] Construction of embodiment 2 plasmid pGAPZa-lacI
[0060] The repressor LacI was introduced into the vector pGAPZa. The repressor protein LacI gene (1083bp) was amplified from the genome of E.coli K12 strain as a template, and its sequence is shown in SEQ ID NO:26:
[0061]atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatc...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com