Unlock instant, AI-driven research and patent intelligence for your innovation.

IPTG-induced tRNA element in pichia pastoris as well as construction method and application thereof

A Pichia pastoris and element technology, applied in the field of IPTG-induced tRNA element in Pichia pastoris and its construction, can solve problems such as non-existence

Pending Publication Date: 2021-04-27
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there is no Pichia tRNA element for inducible expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IPTG-induced tRNA element in pichia pastoris as well as construction method and application thereof
  • IPTG-induced tRNA element in pichia pastoris as well as construction method and application thereof
  • IPTG-induced tRNA element in pichia pastoris as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 12

[0047] The biotin-labeled RNA probe of Example 12 was synthesized at Shanghai Jierui Bioengineering Co., Ltd., and its sequence is:

[0048] Biotin-TTCGAACCCACGaCCATCGCGTTATAAGCACGATGCGCTaaACCACTG, SEQ ID NO:25.

[0049] 3. Medium and culture conditions

[0050] LLB medium: 1% (w / v, the same below) peptone (Tryptone), 0.5% yeast powder (Yeast Extract), 0.5% sodium chloride (NaCl), add deionized water to dissolve. 2% agar powder (Agar) was added when preparing solid plates. Autoclave at 121°C for 20 minutes.

[0051] YPD medium: 2% (w / v, the same below) peptone (Tryptone), 1% yeast powder (Yeast extract), 2% glucose (Glucose), add deionized water to dissolve. 2% agar powder (Agar) was added when preparing solid plates. When preparing, glucose was separately prepared into a 50% solution, sterilized by filtration with a 0.22 μm sterile filter membrane, and stored in a refrigerator at 4°C until use. Peptone and yeast powder were prepared in proportion to a solution, and steri...

Embodiment 1

[0058] Based on the genome sequence of Pichia pastoris GS115 (Pichia pastoris GS115) in the NCBI database, all tRNA gene sequences and copy numbers were determined by the online tool tRNAscan (http: / / lowelab.ucsc.edu / tRNAscan-SE / ). In the following, the tRNA gene carrying the Ile (isoleucine) anticodon as TAT ​​is selected as an example, that is, the expression of tRNA-Ile for further research.

Embodiment 2

[0059] Construction of embodiment 2 plasmid pGAPZa-lacI

[0060] The repressor LacI was introduced into the vector pGAPZa. The repressor protein LacI gene (1083bp) was amplified from the genome of E.coli K12 strain as a template, and its sequence is shown in SEQ ID NO:26:

[0061]atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an IPTG-induced tRNA element in pichia pastoris. The IPTG-induced tRNA element is characterized in that an operator sequence LacO1 of a lactose operon is inserted into a 5'end of a tRNA gene, and LacO2 is inserted into a 3'end of the tRNA gene; and after two-copy treatment, sequences before a GAP promoter sequence of a carrier pGAPZa are connected, and at the same time, a lacI gene with an NSV40 sequence at a N end is inserted behind a GAP promoter of the carrier. The invention further discloses a construction method and application of the IPTG-induced tRNA element in the pichia pastoris. By adopting the tRNA element provided by the invention, the expression of one tRNA can be regulated and controlled through small molecules, and then the codon preference before pichia pastoris can be reversed by expressing a large amount of the tRNA.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to an IPTG-induced tRNA element in Pichia pastoris and its construction method and application. Background technique [0002] Structural genes of bacterial related functions are often linked together to form a gene cluster. They encode different enzymes in the same metabolic pathway. The three genes related to lactose catabolism in Escherichia coli, lacZ, lacY, and lacA are typical of the above-mentioned gene clusters, which encode β-galactosidase, permease and acetyl transfer respectively Enzyme (transacetylase), catalyzes the decomposition of lactose to produce glucose and galactose. In addition, there are regulatory genes: the operator sequence O (operator), the promoter sequence P (promoter), and the Lac repressor (Lacrepressor) encoded by the regulatory gene lacI. This complete regulatory system forms a common regulatory unit, which is called an operon. The ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/81
CPCC12N15/11C12N15/815C12N2800/22C12N2800/102
Inventor 周勉崔璐瑶林茹
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More