Check patentability & draft patents in minutes with Patsnap Eureka AI!

PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof

A technology of telomere length and protein, applied in the field of functional protein

Active Publication Date: 2021-05-28
PEKING UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on functional genes or proteins that activate or regulate telomerase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof
  • PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof
  • PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] About confirming the existence of PTENγ protein, and determining the translation initiation site of PTENγ and its amino acid and nucleotide sequence by constructing PTENγ overexpression vector and mass spectrometry

[0070] 1. Use PTEN antibody and PTENα antibody to identify endogenous PTEN new subtype protein, the specific method is as follows:

[0071]Cells such as HepG2 and U2OS were lysed with hypotonic buffer containing NP40 as the main functional component, mixed with SDS-PAGE loading buffer, cooked at 100°C for 10 minutes, electrophoresed in 6% SDS-PAGE and immunoblotted experiment. Among them, the electrophoresis condition is 80V constant voltage, 2h20min in total, to ensure that the molecular weight marker with a size of 55kDa is located at the bottom of the polyacrylamide gel; the transfer condition is 100mA constant current for 6h. Using PTEN-specific rabbit-derived antibodies to identify PTEN and PTEN subtype proteins, it will be found that except for the P...

Embodiment 2

[0109] In this example, the localization of PTENγ and the localization signal on which the localization depends are clarified by exogenously overexpressing PTENγ protein. The specific implementation method is as follows:

[0110] 1. The construction of eukaryotic exogenously overexpressed protein vectors of each subtype of PTEN, the specific method is as follows:

[0111] The cDNA of HeLa cell line was amplified by PCR to obtain the nucleotide sequence encoding PTENα, which was inserted into the eukaryotic overexpression vector pEGFP-N1 of C-terminal GFP by homologous recombination, and the Kozak sequence was inserted at its 5' end and the start codon Substituted by ATG, the primers used are as follows:

[0112] F: TCGAGCTCAAGCTTCGAATTCGCCACCATGGAGCGGGGGGGAG (SEQ ID NO: 7);

[0113] R: ATGGTGGCGACCGGTGGATCCGCGACTTTTGTAATTTGTGTATGCTG (SEQ ID NO: 8).

[0114] Table 11 List of reaction systems

[0115]

[0116] Table 12 list of reaction conditions

[0117]

[0118] Des...

Embodiment approach

[0139] In this example, a PTENγ-specific knockout cell line was constructed by CRISPR single-base mutation technology, and PTENγ was confirmed to be involved in telomere maintenance and cell proliferation regulation through phenotypic experiments. The implementation method is as follows:

[0140] 1. Construct PTENγ-specific knockout cell lines by VQR-BE3 method:

[0141] 1) Design and construct an expression vector containing gRNA targeting the PTENγ initiation codon, the specific method is as follows:

[0142] For the purpose of mutating the sequence CTG639 corresponding to the PTENγ start codon into a sequence without translation initiation ability, according to the PAM sequence NGAN of VQR-BE3 and the mutation mode G>A or C>T, combined with the DNA sequence near the PTENγ start codon , design gRNA. AGAC at position 624 of the complementary strand was taken as the PAM sequence, and the purpose was to mutate the CAG complementary to the template strand CTG639 into TAG, and d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PTEN subtype protein PTEN gamma participating in telomere length regulation and application thereof, and belongs to the technical field of functional proteins. The amino acid sequence of the PTEN subtype protein PTEN gamma participating in telomere length regulation is as shown in SEQ ID NO: 1. PTEN gamma is a novel PTEN subtype protein, and CUG639 is used as a translation starting point. Protein localization experiments prove that PTEN gamma protein is distributed in a cell nucleus and is obviously enriched in a nucleolus region. The PTEN gamma specific knockout cell line is constructed, and compared with a wild type control group, the telomere length of the PTEN gamma specific knockout cell line is obviously shortened, and the cell proliferation is obviously slowed down, so that the PTEN gamma plays a biological role of participating in telomere length maintenance. Therefore, the invention provides application of the PTEN gamma and the related gene or the recombinant expression vector thereof in preparation of anti-aging or tumor treatment drugs.

Description

technical field [0001] The invention belongs to the technical field of functional proteins, and in particular relates to a PTEN subtype protein PTENγ involved in regulating telomere length and its application. Background technique [0002] Eukaryotic translation often starts from AUG encoding methionine, and its mechanism has been clarified and elaborated in many articles (Sonenberg and Hinnebusch 2009; Jackson et al.2010; Lorsch and Dever 2010 ; Hinnebusch 2017). To ensure that ribosomes start translation at the appropriate start codon, most eukaryotes use a scanning model for translation initiation: Met-carrying tRNAs in eukaryotic translation initiation factor (eIF) and ribosome size subunits Scans mRNA under the combined action of AUG and binds AUG to initiate translation. [0003] As early as the 1980s, it has been found that codons other than AUG can also initiate translation with lower efficiency (Zitomer et al.1984; Peabody 1987,1989; Clements et al.1988; Hann et a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/85A61K48/00A61K38/46A61P35/00A61P39/06
CPCC12N9/16C12N15/85A61K48/005A61K48/0008A61P35/00A61P39/06C12Y301/03C12N2800/107A61K38/00
Inventor 尹玉新梁会夏冯雨
Owner PEKING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More