Unlock instant, AI-driven research and patent intelligence for your innovation.

Mitochondrial variation site database and establishment method and application thereof

A technology of mutation sites and method establishment, applied in the field of bioinformatics, can solve problems such as limiting the application value of databases, failing to guarantee the reliability and consistency of information, and inconsistency

Pending Publication Date: 2021-06-04
GUANGZHOU KINGMED TRANSFORMATIVE MEDICINE INST CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sources of mitochondria in the database, sequencing methods, sequencing depth, data quality control, reference genome, and analysis methods for mutation sites are not uniform, and the reliability and consistency of information cannot be guaranteed, which limits the application value of the database

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mitochondrial variation site database and establishment method and application thereof
  • Mitochondrial variation site database and establishment method and application thereof
  • Mitochondrial variation site database and establishment method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] The establishment of the mitochondrial variation site database includes the following steps:

[0077] 1. Obtain mitochondrial DNA sequence data. In this embodiment, proceed as follows.

[0078] 1. Take the peripheral blood of the individual, and use the Qiagen kit to extract mitochondrial DNA according to its instructions.

[0079] 2. Use DNA polymerase from Novizyme Vazyme Master Mix and primer sequences were used to amplify the extracted DNA by PCR. After the PCR products were obtained, a sequencing library was constructed using Bioo's NEXTflex kit, and then sequenced using the Illumina Novaseq sequencing platform. The primer sequences are:

[0080] F-16426: CCGCACAAGAGTGCTACTCTCCTC (SEQ ID No. 1),

[0081] R-16425: GATATTGATTTCACGGAGGATGGTG (SEQ ID No. 2).

[0082] 2. Compare the above mitochondrial DNA sequence with the mitochondrial reference genome to obtain the comparison result, and capture the mitochondrial variation site information according to the pre...

Embodiment 2

[0105] Query the mitochondrial variation site database and the MITOMAP database in Example 1 respectively, and query the No. 3502 base variation site of the mitochondria.

[0106]The 3502th base T of mitochondria is located in the MT-ND1 gene, which encodes the NADH-ubiquinone oxidoreductase chain 1 protein. Variations in the MT-ND1 gene have been associated with mitochondrial encephalomyopathy, Leber hereditary optic neuropathy, Leigh syndrome, and increased BMI (body mass index) in adults.

[0107] A patient with a suspected mitochondrial disease had a mutation at base 3502 in his mitochondria. In order to check the occurrence of this mutation in the population, he searched the MITOMAP database. The results are as follows: Figure 5 , the query did not return any results.

[0108] And using the mitochondrial mutation site database query established in Example 1, it can be seen that two individuals have mutations in the 3502nd site detected in the population ( Figure 6 ), ...

Embodiment 3

[0110] Inquire respectively in the mitochondrial variation site database and the MITOMAP database in Example 1, and query the 14465th base variation site of the mitochondria.

[0111] The 14465th base G of mitochondria is located in the MT-ND6 gene, which encodes the NADH-ubiquinone oxidoreductase chain 6 protein. Variations in the MT-ND6 gene have been associated with Leber hereditary optic neuropathy, Leigh syndrome, and dystonia.

[0112] A patient with a suspected mitochondrial disease had a mutation at base 14465 in his mitochondria. In order to check the occurrence of this mutation in the population, he searched the MITOMAP database. The results are as follows: Figure 7 , the query did not return any results.

[0113] And using the mitochondrial mutation site database query established in Example 1, it can be seen that an individual has a mutation detected at the 14465th site in the population ( Figure 8 ), its replacement base is A, and its heterogeneity ratio is 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mitochondrial variation site database and an establishment method and application thereof, and relates to the technical field of biological information. The database is established by adopting the following method: acquiring mitochondrial DNA sequence data; comparing the mitochondrial DNA sequence with a mitochondrial reference genome to obtain a comparison result, and capturing mitochondrial variation site information according to a preset condition; performing homogeneity and heterogeneity analysis on the information of each mitochondrial variation site, defining the variation site with the heterogeneity proportion of 0.01-0.98 as heterogeneity variation, otherwise, defining the variation site as homogeneity variation; and integrating variation site information, and summarizing to obtain a mitochondrial variation site database. According to the database, the obtained data quality is uniform and reliable, the data comprises the heterogeneity score of each variation site, and the database has important significance in studying the relation between mtDNA mutation and diseases.

Description

technical field [0001] The invention relates to the technical field of biological information, in particular to a mitochondrial mutation site database and its establishment method and application. Background technique [0002] Mitochondria are key organelles in eukaryotic cells. Mitochondria play an important role in cellular ATP production through oxidative phosphorylation or other functions. Mitochondria contain a separate genome, mitochondrial DNA (mtDNA). Mutations in mtDNA can lead to many human diseases, for example: A3273G mutation (that is, the 3273rd base in the mitochondrial genome changes from A to G) can lead to various diseases such as MELAS. Mitochondrial disease is detected in about 1 in 5000 people. [0003] There are hundreds of copies of mtDNA in a single cell. Homogeneity means that the copies of mtDNA in cells or individuals are the same; while heterogeneity means that cells or individuals contain other types of mtDNA, such as mtDNA containing mutation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G16B20/20G16B30/10G16B50/00G06F16/242G06F16/25G06F16/28
CPCG16B20/20G16B30/10G16B50/00G06F16/242G06F16/252G06F16/284
Inventor 李桂彬蒙裕欢费凌娜黄晓强欧小华严慧缪夏萍范喜杰于世辉梁耀铭
Owner GUANGZHOU KINGMED TRANSFORMATIVE MEDICINE INST CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More