Mitochondrial variation site database and establishment method and application thereof
A technology of mutation sites and method establishment, applied in the field of bioinformatics, can solve problems such as limiting the application value of databases, failing to guarantee the reliability and consistency of information, and inconsistency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] The establishment of the mitochondrial variation site database includes the following steps:
[0077] 1. Obtain mitochondrial DNA sequence data. In this embodiment, proceed as follows.
[0078] 1. Take the peripheral blood of the individual, and use the Qiagen kit to extract mitochondrial DNA according to its instructions.
[0079] 2. Use DNA polymerase from Novizyme Vazyme Master Mix and primer sequences were used to amplify the extracted DNA by PCR. After the PCR products were obtained, a sequencing library was constructed using Bioo's NEXTflex kit, and then sequenced using the Illumina Novaseq sequencing platform. The primer sequences are:
[0080] F-16426: CCGCACAAGAGTGCTACTCTCCTC (SEQ ID No. 1),
[0081] R-16425: GATATTGATTTCACGGAGGATGGTG (SEQ ID No. 2).
[0082] 2. Compare the above mitochondrial DNA sequence with the mitochondrial reference genome to obtain the comparison result, and capture the mitochondrial variation site information according to the pre...
Embodiment 2
[0105] Query the mitochondrial variation site database and the MITOMAP database in Example 1 respectively, and query the No. 3502 base variation site of the mitochondria.
[0106]The 3502th base T of mitochondria is located in the MT-ND1 gene, which encodes the NADH-ubiquinone oxidoreductase chain 1 protein. Variations in the MT-ND1 gene have been associated with mitochondrial encephalomyopathy, Leber hereditary optic neuropathy, Leigh syndrome, and increased BMI (body mass index) in adults.
[0107] A patient with a suspected mitochondrial disease had a mutation at base 3502 in his mitochondria. In order to check the occurrence of this mutation in the population, he searched the MITOMAP database. The results are as follows: Figure 5 , the query did not return any results.
[0108] And using the mitochondrial mutation site database query established in Example 1, it can be seen that two individuals have mutations in the 3502nd site detected in the population ( Figure 6 ), ...
Embodiment 3
[0110] Inquire respectively in the mitochondrial variation site database and the MITOMAP database in Example 1, and query the 14465th base variation site of the mitochondria.
[0111] The 14465th base G of mitochondria is located in the MT-ND6 gene, which encodes the NADH-ubiquinone oxidoreductase chain 6 protein. Variations in the MT-ND6 gene have been associated with Leber hereditary optic neuropathy, Leigh syndrome, and dystonia.
[0112] A patient with a suspected mitochondrial disease had a mutation at base 14465 in his mitochondria. In order to check the occurrence of this mutation in the population, he searched the MITOMAP database. The results are as follows: Figure 7 , the query did not return any results.
[0113] And using the mitochondrial mutation site database query established in Example 1, it can be seen that an individual has a mutation detected at the 14465th site in the population ( Figure 8 ), its replacement base is A, and its heterogeneity ratio is 0....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap