Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of immortalized forest musk gland epithelial cells

A technology of epithelial cells and construction methods, applied in the field of construction of immortalized forest musk gland epithelial cells, can solve problems such as apoptosis, achieve the effect of overcoming apoptosis and ensuring growth speed

Pending Publication Date: 2021-06-25
重庆市药物种植研究所 +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to provide a method for constructing immortalized musk deer gland epithelial cells, so as to solve the technical problem that in the prior art, when musk musk gland cells are cultured, the epithelial cells will undergo apoptosis after the fifth generation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of immortalized forest musk gland epithelial cells
  • Construction method of immortalized forest musk gland epithelial cells
  • Construction method of immortalized forest musk gland epithelial cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1-3

[0058] In following embodiment 1-3:

[0059] The complete epithelial cell culture medium used is PriMed-iCell-001 Saibikang (Shanghai) Biotechnology Co., Ltd.;

[0060] The SV40 overexpression lentivirus used (such as Figure 9 Shown) purchased from Hanyin Biology;

[0061] The target sequence information of the vector is as follows:

[0062] gtggttcaaagtttttttcttccatttcaggtgtcgtgaggatctatttccggtgaattc(atggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgcctgggggaatattcctctgatgagaaaggcatatttaaaaaaatgcaaggagtttcatcctgataaaggaggagatgaagaaaaaatgaagaaaatgaatactctgtacaagaaaatggaagatggagtaaaatatgctcatcaacctgactttggaggcttctgggatgcaactgagattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaacctgttttgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaacattctactcctccaaaaaagaagagaaaggtagaagaccccaaggactttccttcagaattgctaagttttttgagtcatgctgtgtttagtaatagaactcttgcttgctttgctatttacaccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattctgtaacctttataagtaggcataacagttataatcataacatact...

Embodiment 1

[0065] A method for constructing immortalized forest musk gland epithelial cells, comprising the steps of:

[0066] (1) Gather the glandular tissue of male adult muscaria sinensis that fell ill and died during the fragrance secretion stage; transfer it to PBS containing penicillin and streptomycin immediately after gathering, and the penicillin streptomycin is 100U / ml;

[0067] (2) the musk deer gland tissue collected in step (1) (such as figure 1 and figure 2 Shown) the musk deer glandular epithelial cells and fibroblasts are separated and purified to obtain the musk deer musk glandular epithelial cells after purification; specifically include the following steps:

[0068] ①Chop the musk deer gland tissue collected in step (1) to 1-2mm 3 ; Then digested with 0.2% type IV collagenase at 37°C for 4 hours; then resuspended and washed 3 times with complete medium; centrifuged at 1600r / m for 2.5min, and collected the supernatant;

[0069] ② Inoculate the supernatant collected ...

Embodiment 2

[0088] A method for constructing immortalized forest musk gland epithelial cells, comprising the steps of:

[0089] (1) Gather the glandular tissue of male adult muscaria sinensis that fell ill and died during the fragrance secretion stage; transfer it to PBS containing penicillin and streptomycin immediately after gathering, and the penicillin streptomycin is 100U / ml;

[0090] (2) Separating and purifying the musk deer glandular epithelial cells and fibroblasts of the musk deer musk glandular tissue collected in step (1) to obtain the musk deer musk glandular epithelial cells after purification; specifically comprising the following steps:

[0091] ①Chop the musk deer gland tissue collected in step (1) to 1-2mm 3 ; Then digested with 0.3% type IV collagenase at 37°C for 5 hours; then resuspended and washed twice with complete medium; centrifuged at 1300r / m for 3min, and collected the supernatant;

[0092] ② Inoculate the supernatant collected in step ① into a complete medium...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of immortalized forest musk gland epithelial cells. The construction method comprises the following steps: (1) collecting musk gland tissues of a male adult forest musk dead due to illness in a fragrance secretion period; (2) separating and purifying the forest musk gland epithelial cells and fibroblasts of the forest musk gland tissues to obtain purified lindel gland epithelial cells; (3) carrying out lentivirus transfection on the purified forest musk gland epithelial cells to obtain transfected forest musk gland epithelial cells; (4) screening out successfully transfected forest musk gland epithelial cells from the transfected forest musk gland epithelial cells through puromycin; and (5) carrying out multiplication culture on the screened successfully transfected forest musk gland epithelial cells to obtain the immortalized forest musk gland epithelial cells. According to the construction method of the immortalized forest musk gland epithelial cells, the immortalized forest musk gland epithelial cells are immortalized in a lentivirus transfection mode, the characteristics of the epithelial cells can be completely kept after 12 generations of culture, and the defect of epithelial cell apoptosis is overcome.

Description

technical field [0001] The invention relates to the technical field of animal tissue culture, in particular to a method for constructing immortalized forest musk gland epithelial cells. Background technique [0002] Musk is an important ingredient in traditional Chinese medicine. The 2020 edition of "Chinese Pharmacopoeia" records that musk has the effects of resuscitating the mind, promoting blood circulation, reducing swelling and relieving pain. Modern pharmaceutical works all regard musk as the treasure of medicinal materials. In the actual application of Chinese patent medicines and patent medicines, musk often ranks first among precious animal medicinal materials such as bezoar, rhinoceros horn, and bear bile. Of the 2,621 prescriptions recorded in the National Prescription Collection of Chinese Patent Medicine, 295 prescriptions contain musk. Because the output of natural musk is extremely low, each male forest musk deer can only produce about 15 grams per year, so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/65C12N5/10C12N5/071
CPCC12N15/86C12N15/65C12N5/0633C12N2740/15043C12N2800/107C12N2510/04C12N2509/10C12N2509/00
Inventor 竭航郑程莉赵春容张明任妍
Owner 重庆市药物种植研究所
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com