Micro-fluidic chip for virus joint detection and application thereof

A microfluidic chip, combined detection technology, applied in laboratory containers, microbial determination/inspection, biochemical equipment and methods, etc. It can save manpower and material resources, has good specificity and is easy to use.

Active Publication Date: 2021-07-13
SOUTH UNIVERSITY OF SCIENCE AND TECHNOLOGY OF CHINA
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this product needs to be used in conjunction with the corresponding fluorescent PCR instrument, which requires a high level of testing personnel, and there are fewer types of viruses detected, which limits the promotion of the product
[0004] At present, the virus joint detection products on the market often have the problems of fewer detection types, more complicated detection operations, higher requirements for operators and detection environment, and higher detection costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Micro-fluidic chip for virus joint detection and application thereof
  • Micro-fluidic chip for virus joint detection and application thereof
  • Micro-fluidic chip for virus joint detection and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] This embodiment provides a microfluidic chip for joint detection of viruses, and its overall appearance picture is as follows figure 2 As shown, the cross-sectional view is as image 3 shown.

[0066] The microfluidic chip is distributed with a sample loading area, a hybridization area and a waste liquid area from top to bottom according to the direction of liquid flow;

[0067] The sample loading area includes a reaction solution pipeline located inside the microfluidic chip and a sample loading hole that communicates with the outside world, and the hybridization area and waste liquid area are located inside the microfluidic chip;

[0068] The reaction solution pipeline and the sample injection hole are respectively connected to the hybridization area through liquid pipelines, and the hybridization area is connected to the waste liquid area through waste liquid pipelines;

[0069] A shared rotary valve is arranged between the liquid pipeline and the waste liquid pip...

Embodiment 2

[0077] In this example, hybridization solution, washing solution A, incubation solution, incubation solution, washing solution B and chromogenic solution were added to the microfluidic chip for virus joint detection constructed in Example 1, and the new type A H1N1 was immobilized on the hybridization membrane Influenza virus detection probe, influenza B virus detection probe, influenza A virus detection probe, influenza A H3N2 influenza virus detection probe, novel coronavirus detection probe and respiratory syncytial virus detection probe, made of respiratory virus The microfluidic chip for joint detection is as follows:

[0078] The hybridization solution is a 2×SSC solution containing 0.2% SDS;

[0079] The lotion A is a 1×SSC solution containing 0.2% SDS;

[0080] The incubation solution is a horseradish peroxidase solution containing 0.5U;

[0081] The lotion B is a 0.5×SSC solution of 1% SDS;

[0082] The chromogenic solution is 2.5 mg / ml TMB solution.

[0083] On t...

Embodiment 3

[0092] In this example, the microfluidic chip for joint detection of respiratory viruses prepared in Example 2 is used to detect the samples, and the specific steps are as follows:

[0093] (1) Sample amplification

[0094] Amplification primers of 6 kinds of viruses are used to amplify the test samples, wherein the sequences of the novel influenza A (H1N1) influenza virus detection primers are shown in SEQ ID Nos. 7 to 8, and the sequences of the influenza B virus detection primers are shown in SEQ ID No. Shown in .9~10, the sequence of influenza A virus detection primer is shown in SEQ ID No.11~12, the sequence of influenza A H3N2 influenza virus detection primer is shown in SEQ ID No.13~14, the new coronavirus detection The sequences of the primers are shown in SEQ ID No.15-16, and the sequences of the primers for detecting respiratory syncytial virus are shown in SEQ ID Nos.17-18.

[0095] SEQ ID No. 7: GCCTCATACAAGATCTTCAG;

[0096] SEQ ID No. 8: CACACACATGTGATTTCACTAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a micro-fluidic chip for virus joint detection and and application thereof. The micro-fluidic chip is provided with a sample adding area, a hybridization area and a waste liquid area from top to bottom in the liquid flowing direction; the sample adding area comprises a reaction liquid pipeline located in the micro-fluidic chip and a sample adding hole communicated with the outside, and the hybridization area and the waste liquid area are located in the micro-fluidic chip; the reaction liquid pipeline and the sample adding hole are respectively connected with the hybridization area through liquid pipelines, and the hybridization area is connected with the waste liquid area through a waste liquid pipeline; and a shared rotary valve is arranged between the liquid pipeline and the waste liquid pipeline. The invention also provides a use method of the micro-fluidic chip for virus joint detection for the purpose of non-disease diagnosis and / or treatment. The micro-fluidic chip for virus joint detection is simple in structure and convenient to operate and carry; and the detection result is accurate, the specificity is good, the sensitivity is high, no pollution is caused to the environment, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the technical field of virus typing and detection, and in particular relates to a microfluidic chip for virus joint detection and an application thereof. Background technique [0002] Viral infection can cause various viral diseases, which are of various types and have different symptoms, and are contagious and endanger people's health. Different types of viral infections may produce similar clinical symptoms, such as rotavirus, enteric adenovirus, norovirus and astrovirus infection can all cause diarrhea, and coronavirus and influenza viruses can cause colds, runny nose, etc. , cough and fever symptoms. There are corresponding treatment methods for different viruses. Similar symptoms bring difficulties to the identification and diagnosis of diseases, and also affect the timing and effect of treatment. At the same time, it also increases the difficulty and workload of disease prevention and control. [0003] Therefore, it is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): B01L3/00C12Q1/6837
CPCB01L3/5027C12Q1/6837B01L2200/0689B01L2300/0819C12Q2565/629
Inventor蒋兴宇王斗
OwnerSOUTH UNIVERSITY OF SCIENCE AND TECHNOLOGY OF CHINA