Micro-fluidic chip for virus joint detection and application thereof
A microfluidic chip, combined detection technology, applied in laboratory containers, microbial determination/inspection, biochemical equipment and methods, etc. It can save manpower and material resources, has good specificity and is easy to use.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] This embodiment provides a microfluidic chip for joint detection of viruses, and its overall appearance picture is as follows figure 2 As shown, the cross-sectional view is as image 3 shown.
[0066] The microfluidic chip is distributed with a sample loading area, a hybridization area and a waste liquid area from top to bottom according to the direction of liquid flow;
[0067] The sample loading area includes a reaction solution pipeline located inside the microfluidic chip and a sample loading hole that communicates with the outside world, and the hybridization area and waste liquid area are located inside the microfluidic chip;
[0068] The reaction solution pipeline and the sample injection hole are respectively connected to the hybridization area through liquid pipelines, and the hybridization area is connected to the waste liquid area through waste liquid pipelines;
[0069] A shared rotary valve is arranged between the liquid pipeline and the waste liquid pip...
Embodiment 2
[0077] In this example, hybridization solution, washing solution A, incubation solution, incubation solution, washing solution B and chromogenic solution were added to the microfluidic chip for virus joint detection constructed in Example 1, and the new type A H1N1 was immobilized on the hybridization membrane Influenza virus detection probe, influenza B virus detection probe, influenza A virus detection probe, influenza A H3N2 influenza virus detection probe, novel coronavirus detection probe and respiratory syncytial virus detection probe, made of respiratory virus The microfluidic chip for joint detection is as follows:
[0078] The hybridization solution is a 2×SSC solution containing 0.2% SDS;
[0079] The lotion A is a 1×SSC solution containing 0.2% SDS;
[0080] The incubation solution is a horseradish peroxidase solution containing 0.5U;
[0081] The lotion B is a 0.5×SSC solution of 1% SDS;
[0082] The chromogenic solution is 2.5 mg / ml TMB solution.
[0083] On t...
Embodiment 3
[0092] In this example, the microfluidic chip for joint detection of respiratory viruses prepared in Example 2 is used to detect the samples, and the specific steps are as follows:
[0093] (1) Sample amplification
[0094] Amplification primers of 6 kinds of viruses are used to amplify the test samples, wherein the sequences of the novel influenza A (H1N1) influenza virus detection primers are shown in SEQ ID Nos. 7 to 8, and the sequences of the influenza B virus detection primers are shown in SEQ ID No. Shown in .9~10, the sequence of influenza A virus detection primer is shown in SEQ ID No.11~12, the sequence of influenza A H3N2 influenza virus detection primer is shown in SEQ ID No.13~14, the new coronavirus detection The sequences of the primers are shown in SEQ ID No.15-16, and the sequences of the primers for detecting respiratory syncytial virus are shown in SEQ ID Nos.17-18.
[0095] SEQ ID No. 7: GCCTCATACAAGATCTTCAG;
[0096] SEQ ID No. 8: CACACACATGTGATTTCACTAGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


