Polypeptide with binding affinity to HPV16E6 protein and application thereof

A HPV16E6, affinity technology, applied in the field of biomedicine, can solve the problems of serious immunogenicity, toxic and side effects, reduced function, high cost, etc.

Pending Publication Date: 2021-07-27
WENZHOU MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, targeted therapy based on antibody molecules still has limitations in its application, such as poor permeability, high cost, strong immunogenicity and serious side effects, etc., which need further research and improvement
In particular, the toxic effects caused by toxic side effects have become the main obstacle to the development of therapeutic antibodies against tumors, and the toxicity of the liver, kidney and nervous system will reduce their functions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide with binding affinity to HPV16E6 protein and application thereof
  • Polypeptide with binding affinity to HPV16E6 protein and application thereof
  • Polypeptide with binding affinity to HPV16E6 protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 Wencative Construction and Screening of HPV16E6 binding polypeptide

[0084] The phage showing the random combination library of HPV16E6 binding polypeptides, that is, many different SPA domain-related polypeptides, HPV16E6 binding polypeptides, and identified their affinity.

[0085] 1. Construction and identification of the random combination phage display library of HPV16E6 binding polypeptide

[0086] According to the amino acid sequence and structure of wild type SPA-Z (Nilsson B et al, Protein ENG.1987; 1 (2): 107-113), a random primer is designed for the coding sequence corresponding to the three helix structural regions, and the PCR method is expanded. Increasing the SPA coding sequence that can cause random amino acid mutations, named SPA-N.

[0087] 2, construction of PCANTAB5E / SPA-N recombinant plasmid

[0088] Choose the expression of affinity in the M13 phage system (purchased from Beijing Baocovi Food Anni Company), with Pcantab5e (purchased from B...

Embodiment 2

[0095] Example 2 HPV16E6 binding polypeptide recombinant plasmid structure and prokaryotic expression and purification

[0096] Select 3 clones with higher PHAGE-ELISA reading as before, figure 1 Zeng HPV16E6 1115, Z HPV16E6 1171, Z HPV16E6 1235) In order to perform functional detection of the screening of Affibody molecules, the recombinant plasmid is built, the expression of the prototype protein and its identification, and purified protein are prepared.

[0097] 1. Recombinant plasmid construction and identification of PET21A (+) / Affibody

[0098] Refer to the Affibody gene sequence (GenBank: GY324633.1) Design PCR primer, upstream primers 5'GGAATTC Catatg GTTGACAACAAATTCAACAAAAAGAA 3 '(SEQ ID NO: 10, the underscore represents NED I enzyme dug point), downstream primer 5'ccg CTCGAG TTTCGGAGCCTGAGCGTCG3 '(SEQ ID NO: 11, the underscore represents an XHO I enzyme dug bit); the sequence of sequencing is correct, the three-level library single cloned AFFIBODY Z HPV16E6 1115, Z HPV...

Embodiment 3

[0101] Example 3, Z HPV16E6 Affibody polypeptide combination with HPV16E6 protein

[0102] To identify Z HPV16E6 Affibody polypeptide and HPV16E6 protein-binding specificity, three Zs, screening, plasma resonance techniques (SPR) HPV16E6 1115, Z HPV16E6 1171, Z HPV16E6 1235 molecules and their control ZwtaffiBody and the specific binding of target protein HPV16E6.

[0103] (1) Preparation and identification of HPV16E6 recombinant proteins

[0104] The HPV16E6 gene was amplified from the PCR method, cloned to the PET21a (+) vector, and constructed PET21A (+) / HPV16E6 recombinant plasmid, and transformed sequencing identification and completely correct recombinant plasmid PET21a (+) / HPV16E6 to E.COLI BL21 (DE3) strain. Inducing expression by 1 mm IPTG, SDS-PAGE electrophoresis showed more concentrated induced strips at 14kda, consistent with the theoretical value ( Figure 5 ). After ultrasonic cracking, SDS-PAGE electrophoresis analyzes recombinant proteins in the precipitate in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to polypeptide with binding affinity to HPV16E6 protein and an application thereof, by taking a Z structural domain of a staphylococcus protein A as a bracket, randomly mutating amino acid residue simulation antibody binding sites on the surface of the Z structural domain, constructing a mutant library through a phage display technology, carrying out affinity screening on the library by taking HPV16E6 as a target antigen, and finally obtaining the polypeptide with high affinity to HPV16E6 through a large amount of screening work. Through deep research, the invention discloses the polypeptide with binding affinity to E6 protein of HPV16 for the first time, and in addition, the invention also provides diagnosis or treatment application of the polypeptide as a medicine or a molecular targeting reagent.

Description

Technical field [0001] The present invention relates to the field of biomedicine, and more particularly, the present invention relates to a polypeptide having a binding affinity for HPV16E6 protein and its application. Background technique [0002] Cervical cancer is the second common cause of death in women cancer in global women. It is reported that the annual new cases reached 445,000 cases, of which about 270,000 were killed. Studies from clinical, epidemiological and molecular biological data have confirmed more than 95% of patients with cervical cancer and high-risk human papillomavirus (HPVS), indicating sustained infection with high-risk human papillomavirus (HR- HPV), including HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59, which is the main cause of pathogenic causes of cervical cancer. Among them, HPV16 and HPV18 are the most common genotype, accounting for 62.6% and 15.7% of cervical tumors, respectively. [0003] HPV is a non-enclosed, double-stranded, cycli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/31C12N15/31C12N15/70C12N1/21G01N33/569G01N33/574A61K47/64A61P31/20A61P35/00C12R1/19
CPCC07K14/31C12N15/70G01N33/56983G01N33/57411G01N33/57407A61K47/64A61P31/20A61P35/00G01N2333/31G01N2333/025
Inventor张丽芳陈俊朱珊丽朱进顺
OwnerWENZHOU MEDICAL UNIV