Method for constructing DNA bar code database of fishes in Lake Taihu and application
A barcode and database technology, applied in the field of molecular biology, can solve problems such as blanks in the barcode database of local species, differences in genotype, barcode information, and the inability of local species to be correctly identified, so as to improve retrieval efficiency, improve accuracy, and prevent samples. mixed effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] (1) Data investigation and sampling arrangements: consult literature, connect with the fishery department of Taihu Lake, collect data such as hydrology, biological life cycle and geographical distribution of Taihu Lake, and do a good job in basic work for fish sample collection. The sampling time is determined to be December 2018; Taihu Lake is divided into seven lake areas: Eastern Lake District, Southern Lake District, Western Lake District, Zhushan Bay, Meiliang Bay, Gonghu Bay, and Lake Central District, and 3 sampling points are set for each lake district bit.
[0031] (2) Sample collection and identification: Fish were quantitatively collected using a combination of 3 multi-mesh gillnets and 3 custom-made ground cages. Three representative strips were selected for each variety, and a single individual was photographed and recorded with a scaled background plate ( figure 1 ), and brought back as laboratory analysis samples refrigerated, the refrigerated temperatur...
Embodiment 2
[0037] Change the primer sequence of embodiment 1 step (4) PCR amplification and product detection to: upstream primer (5'-3'): TCGTGCCAGCCACCGCGGTTA; downstream primer (5'-3'):
[0038] ATAGTGGGGTATCTAATCCCAG. Others are the same as in Example 1, and the length of the amplified product is about 200bp. Figure 6 It is the loach DNA barcode amplified with the primers in Example 2. This result shows that the primers used in Example 1 are more suitable for constructing the fish DNA barcode database in the Taihu Basin.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



