Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing DNA bar code database of fishes in Lake Taihu and application

A barcode and database technology, applied in the field of molecular biology, can solve problems such as blanks in the barcode database of local species, differences in genotype, barcode information, and the inability of local species to be correctly identified, so as to improve retrieval efficiency, improve accuracy, and prevent samples. mixed effect

Pending Publication Date: 2021-08-10
江苏省常州环境监测中心
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The conclusion of the study may have a great impact on the current DNA detection technology and data analysis methods
Moreover, the barcode database of native species for specific regions in my country, especially the Taihu Lake Basin, is still blank
Because different subspecies or different ecotypes of the same species belong to the same species in taxonomy, but there are more or less differences in their genotype and barcode information
Due to the lack of barcode data of native species, the barcode sequences obtained by the determination can only be compared with international databases, and because of the inherent differences in barcode information, a large number of native species cannot be correctly identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing DNA bar code database of fishes in Lake Taihu and application
  • Method for constructing DNA bar code database of fishes in Lake Taihu and application
  • Method for constructing DNA bar code database of fishes in Lake Taihu and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] (1) Data investigation and sampling arrangements: consult literature, connect with the fishery department of Taihu Lake, collect data such as hydrology, biological life cycle and geographical distribution of Taihu Lake, and do a good job in basic work for fish sample collection. The sampling time is determined to be December 2018; Taihu Lake is divided into seven lake areas: Eastern Lake District, Southern Lake District, Western Lake District, Zhushan Bay, Meiliang Bay, Gonghu Bay, and Lake Central District, and 3 sampling points are set for each lake district bit.

[0031] (2) Sample collection and identification: Fish were quantitatively collected using a combination of 3 multi-mesh gillnets and 3 custom-made ground cages. Three representative strips were selected for each variety, and a single individual was photographed and recorded with a scaled background plate ( figure 1 ), and brought back as laboratory analysis samples refrigerated, the refrigerated temperatur...

Embodiment 2

[0037] Change the primer sequence of embodiment 1 step (4) PCR amplification and product detection to: upstream primer (5'-3'): TCGTGCCAGCCACCGCGGTTA; downstream primer (5'-3'):

[0038] ATAGTGGGGTATCTAATCCCAG. Others are the same as in Example 1, and the length of the amplified product is about 200bp. Figure 6 It is the loach DNA barcode amplified with the primers in Example 2. This result shows that the primers used in Example 1 are more suitable for constructing the fish DNA barcode database in the Taihu Basin.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses a method for constructing a Tai Lake fish DNA bar code database and application. The method comprises six operation steps of data investigation and collection, sample collection and identification, mitochondrial genome DNA extraction, PCR amplification and product detection, PCR product sequencing and result analysis and DNA bar code data arrangement and database construction. The accuracy of fish species identification can be effectively improved through a molecular biological method, and the constructed Taihu Lake fish DNA barcode database can be applied to ecological environment monitoring and provides support for efficient, rapid and standardized biological monitoring.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method and application for constructing a DNA barcode database of Taihu fish. Background technique [0002] The change of fish community structure is a response to human influence and changes in the water ecological environment. The evolution of related processes may not only lead to the degradation of fishery functions, but also cause the lake ecosystem to lose the important function of self-regulation. Therefore, investigating the fish community in Taihu Lake and incorporating it into the water ecological health evaluation system will become an important evaluation basis for lake management and ecosystem restoration. With the development and progress of molecular biology technology, it becomes possible to apply DNA barcoding technology to fish community monitoring. [0003] DNA barcoding, which uses a nucleotide sequence to distinguish organisms at diff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6869
CPCC12Q1/6888C12Q1/6869C12Q2600/156C12Q2531/113C12Q2563/185
Inventor 何梦晓张翔陈桥沈丽娟沈伟
Owner 江苏省常州环境监测中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com