Unlock instant, AI-driven research and patent intelligence for your innovation.

Yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and construction method thereof

A technology of Escherichia coli and shuttle plasmids, which is applied in the biological field and can solve problems such as membrane structure damage

Pending Publication Date: 2021-09-10
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

hok encodes a highly toxic transmembrane protein that can cause irreversible damage to membrane structures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and construction method thereof
  • Yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and construction method thereof
  • Yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of the Yeast-Escherichia coli Shuttle Plasmid Stably Inherited in Escherichia coli

[0045] The shuttle plasmid is based on the bacterium-yeast artificial chromosome pCC1BAC-YAC (its nucleotide sequence is shown in SEQID NO.4), the hok-sok and par sites are obtained from the pGEN-MCS plasmid by PCR amplification, and the The stable genetic elements (hok-sok and par) were constructed into pCC1BAC-YAC to obtain a pCC1-sok / par shuttle plasmid vector that is convenient for cloning long fragment DNA, has no resistance and stable inheritance, and its physical map is as follows: figure 1 shown. Specifically, the pCC1-sok / par shuttle plasmid vector is constructed by the following method:

[0046] (1) Using pGEN-MCS as a template, design primers and add homology arms upstream and downstream of the primers. The nucleotide sequences of the primers are as follows:

[0047] SOK / PAR-F:

[0048] AAGGATCCGGCGTAATCATGACAACATCAGCAAGGAGAAAG

[0049] SOK / PAR-R: ...

Embodiment 2

[0064] The resistance stability test of embodiment 2pCC1-sok / par recombinant plasmid

[0065] (1) Verification method of genetic stability: take the EPI300 bacterium liquid with pCC1-sok / par plasmid, streak on the non-resistant LB plate (as the first generation plate); pick 50 single colonies, and Inoculate the plate on the LB plate containing chloramphenicol. After culturing overnight, observe and record the proportion of colonies containing resistance.

[0066] (2) Pick a single colony from the first-generation plate and streak it on the non-resistant LB plate (considered the second-generation plate) for subculture; pick 50 single colonies to verify resistance, and record those containing resistance Colony ratio.

[0067] (3) By analogy, subculture to the 70th generation plate to check the genetic stability of the plasmid.

[0068] Figure 4 The results showed that no loss of chloramphenicol resistance was found in the 67th generation. When passing to the 68th, 69th, and...

Embodiment 3

[0069] The sequence stability test of embodiment 3pCC1-sok / par recombinant plasmid

[0070] Randomly pick a single colony of the pCC1-sok / par recombinant plasmid passed on the 67 generation plate, use primers pCC1-cmR-Fn and pCC1-cmR-Rn to carry out colony PCR, verify the chloramphenicol resistance gene ( Figure 5 Lanes 1-7), using primers pCC1-CENars-F and pCC1-CENars-R to verify the yeast replicon ( Figure 5 Lanes 8-14).

[0071] pCC1-cmR-FnTTCACATTCTTGCCCGCCTG

[0072] pCC1-cmR-Rn ACTGGTGAAACTCACCCAGG

[0073] pCC1-CENars-FGATCGCTTGCCTGTAACTTACAC

[0074] pCC1-CENars-R AGGGCCTCGTGATACGCC

[0075] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, cycle amplification 30 times, and extension at 72°C for 10 min. PCR products were detected by agarose gel electrophoresis.

[0076] The result is as Figure 5 shown. Figure 5 The results showed that ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and a construction method of the yeast-Escherichia coli shuttle plasmid. The yeast-Escherichia coli shuttle plasmid, which is convenient in cloning of long-fragment DNA, is free of resistance and is stably inherited in the Escherichia coli, is obtained through the following steps: based on a bacterium-yeast artificial chromosome, carrying out PCR (Polymerase Chain Reaction) amplification on a pGEN-MCS plasmid to obtain hok-sok and par elements, and then, constructing stable genetic elements, i.e., hok-sok and parA into the bacterium-yeast artificial chromosome through connection. Preferably, the nucleotide sequence of the shuttle plasmid is as shown in SEQ ID NO. 1. The shuttle plasmid vector provided by the invention not only can realize shuttling in yeast and bacteria and perform multi-fragment-DNA assembly in the yeast through homologous recombination, but also can be stably copied and inherited in the Escherichia coli, and thus, DNA extraction is facilitated.

Description

technical field [0001] The invention relates to a shuttle plasmid and a construction method thereof, in particular to a yeast-Escherichia coli shuttle plasmid and a construction method thereof stably inherited in Escherichia coli. The invention belongs to the field of biotechnology. Background technique [0002] With the gradual improvement of my country's economic level, the material living standards of residents are also constantly improving, and the consumption level of meat is also increasing year by year. Therefore, in recent years, my country's animal husbandry industry has developed very rapidly. However, with the increase in the variety and number of animals in the animal husbandry industry, the occurrence and development of animal diseases are also worrying, forming new challenges, such as the recent African swine fever epidemic, suis streptococcal disease and brucellosis. Vaccination is one of the effective methods to prevent and control animal vaccines. Among t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N15/70C12N15/66
CPCC12N15/81C12N15/70
Inventor 蔡文通李干武步志高赵东明
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI