Yeast-Escherichia coli shuttle plasmid stably inherited in Escherichia coli and construction method thereof
A technology of Escherichia coli and shuttle plasmids, which is applied in the biological field and can solve problems such as membrane structure damage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Construction of the Yeast-Escherichia coli Shuttle Plasmid Stably Inherited in Escherichia coli
[0045] The shuttle plasmid is based on the bacterium-yeast artificial chromosome pCC1BAC-YAC (its nucleotide sequence is shown in SEQID NO.4), the hok-sok and par sites are obtained from the pGEN-MCS plasmid by PCR amplification, and the The stable genetic elements (hok-sok and par) were constructed into pCC1BAC-YAC to obtain a pCC1-sok / par shuttle plasmid vector that is convenient for cloning long fragment DNA, has no resistance and stable inheritance, and its physical map is as follows: figure 1 shown. Specifically, the pCC1-sok / par shuttle plasmid vector is constructed by the following method:
[0046] (1) Using pGEN-MCS as a template, design primers and add homology arms upstream and downstream of the primers. The nucleotide sequences of the primers are as follows:
[0047] SOK / PAR-F:
[0048] AAGGATCCGGCGTAATCATGACAACATCAGCAAGGAGAAAG
[0049] SOK / PAR-R: ...
Embodiment 2
[0064] The resistance stability test of embodiment 2pCC1-sok / par recombinant plasmid
[0065] (1) Verification method of genetic stability: take the EPI300 bacterium liquid with pCC1-sok / par plasmid, streak on the non-resistant LB plate (as the first generation plate); pick 50 single colonies, and Inoculate the plate on the LB plate containing chloramphenicol. After culturing overnight, observe and record the proportion of colonies containing resistance.
[0066] (2) Pick a single colony from the first-generation plate and streak it on the non-resistant LB plate (considered the second-generation plate) for subculture; pick 50 single colonies to verify resistance, and record those containing resistance Colony ratio.
[0067] (3) By analogy, subculture to the 70th generation plate to check the genetic stability of the plasmid.
[0068] Figure 4 The results showed that no loss of chloramphenicol resistance was found in the 67th generation. When passing to the 68th, 69th, and...
Embodiment 3
[0069] The sequence stability test of embodiment 3pCC1-sok / par recombinant plasmid
[0070] Randomly pick a single colony of the pCC1-sok / par recombinant plasmid passed on the 67 generation plate, use primers pCC1-cmR-Fn and pCC1-cmR-Rn to carry out colony PCR, verify the chloramphenicol resistance gene ( Figure 5 Lanes 1-7), using primers pCC1-CENars-F and pCC1-CENars-R to verify the yeast replicon ( Figure 5 Lanes 8-14).
[0071] pCC1-cmR-FnTTCACATTCTTGCCCGCCTG
[0072] pCC1-cmR-Rn ACTGGTGAAACTCACCCAGG
[0073] pCC1-CENars-FGATCGCTTGCCTGTAACTTACAC
[0074] pCC1-CENars-R AGGGCCTCGTGATACGCC
[0075] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, cycle amplification 30 times, and extension at 72°C for 10 min. PCR products were detected by agarose gel electrophoresis.
[0076] The result is as Figure 5 shown. Figure 5 The results showed that ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


