Long non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma

A non-coding technology for the treatment of liver cancer, applied in the field of genetic engineering, can solve the problems of low surgical resection rate, poor overall prognosis of HCC patients, and incomplete understanding of the pathogenesis of liver cancer.

Pending Publication Date: 2021-10-08
ZHEJIANG MEDICAL COLLEGE +2
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although great progress has been made in cancer treatment both clinically and experimentally, the overall prognosis of HCC patients is poor due to the high rate of tumor recurrence and metastasis after surgery
my country is an area with a high incidence of liver cancer, and most patients with liver cancer in my country have a background of hepatitis B infection, often combined with liver insufficiency, cirrhosis, etc., resulting in a low surgical resection rate and a high recurrence rate
Although many genes and signaling pathways have been discovered and confirmed to be related to the occurrence, development and regulation of liver cancer, the pathogenesis of liver cancer is still not fully understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma
  • Long non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma
  • Long non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Differential expression and clinical significance of MAPKAPK5-AS1 in liver cancer

[0065] GEO and TCGA public databases were analyzed to identify lncRNAs that may play important biological functions in liver cancer progression, and found that lncRNA MAPKAPK5-AS1 (SEQ ID NO.1) was consistently elevated in liver cancer, and subsequently, our qRT- PCR results confirmed high expression of MAPKAPK5-AS1 in HCC tissues compared with adjacent non-tumor tissues,

[0066] The primer sequences are: MAPKAPK5-AS1-F (Seq ID NO.2): GGCGTCGTGAGGTATGGATGTTC, MAPKAPK5-AS1-R (Seq ID NO.3): GCTTGACCACTTCTCGGCTGTG.

[0067] In addition, Kaplan-Meier survival analysis of 97 HCC patients and patient data in the TCGA database showed that HCC patients with high MAPKAPK5-AS1 expression exhibited significantly worse overall survival. Taken together, these results suggest that MAPKAPK5-AS1 is upregulated in HCC, which is associated with poor clinical features and prognosis in HCC pati...

Embodiment 2

[0068] Example 2: MAPKAPK5-AS1 promotes proliferation and inhibits apoptosis of HCC cells in vitro

[0069] To investigate the biological function of MAPKAPK5-AS1, we stably knocked down MAPKAPK5-AS1 in HCCLM3 and MHCC97-H cells, and overexpressed MAPKAPK5-AS1 in Hep3B and Huh-7 cells. MAPKAPK5-AS1 knockdown significantly inhibited the viability and proliferation of HCCLM3 and MHCC97-H cells in MTT, colony formation and EdU assays. While MAPKAPK5-AS1 overexpression significantly enhanced the viability and proliferation of Hep3B and Huh-7 cells, in addition, flow cytometry analysis showed that knockdown of MAPKAPK5-AS1 in HCCLM3 and MHCC97-H cells significantly induced apoptosis, While overexpression of MAPKAPK5-AS1 in Hep3B and Huh-7 cells strongly inhibited apoptosis. These results above indicate that MAPKAPK5-AS1 promotes the proliferation of HCC cells by inhibiting apoptosis (eg figure 2 ).

Embodiment 3

[0070] Example 3: MAPKAPK5-AS1 promotes the migration and EMT process of HCC cells in vitro

[0071] Transwell migration and invasion experiments were performed to explore the effect of MAPKAPK5-AS1 on cell migration, and the results showed that knockdown of MAPKAPK5-AS1 in HCCLM3 and MHCC97-H significantly inhibited the migration and invasion of tumor cells, while overexpression of MAPKAPK5-AS1 Significantly enhanced the migration of Hep3B and Huh-7 cells. Considering that EMT is a key mechanism mediating cancer metastasis, the effect of MAPKAPK5-AS1 on the EMT process of tumor cells was further investigated. Western blot analysis showed that MAPKAPK5-AS1 knockdown in HCCLM3 and MHCC97-H significantly increased the expression of E-cadherin and decreased the levels of N-cadherin and vimentin. Opposite regulation of EMT marker expression was observed after overexpression of MAPKAPK5-AS1 in Hep3B and Huh-7 cells. Therefore, our above results suggest that MAPKAPK5-AS1 promotes ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a long non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma. The long non-coding RNA is long non-coding RNA lncRNA MAPKAPK5-AS1, a gene ID of the long non-coding RNA is ENSG00000234608, the long non-coding RNA is positioned at 12q24.12, and a nucleotide sequence of the lncRNA MAPKAPK5-AS1 is shown as Seq ID NO.1. The invention finds that the lncRNA MAPKAPK5-AS1 can be used as a diagnostic biomarkerand a drug treatment target for hepatocellular carcinoma for the first time, and provides that an MAPKAPK5-AS1 / PLAGL2 / HIF-1alpha loop can be used as a diagnosis and treatment target for hepatocellular carcinoma. The lncRNA MAPKAPK5-AS1 is obviously up-regulated in hepatocellular carcinoma tissues, and MAPKAPK5-AS1 inhibition can be used for inhibiting proliferation, migration and EMT of HCC cells and inducing apoptosis.

Description

Technical field: [0001] The invention relates to the field of genetic engineering, in particular to a long non-coding RNA and its application in the diagnosis and treatment of liver cancer. Background technique: [0002] Hepatocellular carcinoma (HCC) is a common malignant tumor of the digestive system, and its morbidity and mortality rank sixth and fourth in the world, respectively. Although great progress has been made in cancer treatment both clinically and experimentally, the overall prognosis of HCC patients is poor due to the high rate of tumor recurrence and metastasis after surgery. my country is an area with a high incidence of liver cancer, and most patients with liver cancer in my country have a background of hepatitis B infection, often combined with liver insufficiency, cirrhosis, etc., resulting in a low surgical resection rate and a high recurrence rate. Although many genes and signaling pathways have been discovered and confirmed to be related to the occurre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113A61K45/00A61P35/00
CPCC12Q1/6886A61K45/00A61P35/00C12Q2600/118C12Q2600/178C12Q2600/158
Inventor涂康生许秋然黄东胜胡晓歌曾帜
OwnerZHEJIANG MEDICAL COLLEGE