Application of p-benzoquinone and/or p-benzoquinone derivatives in the preparation of anti-novel coronavirus drugs
A coronavirus and p-benzoquinone technology, applied in antiviral agents, resistance to vector-borne diseases, pharmaceutical formulations, etc., to achieve the effect of inhibiting activity and proliferation, and alleviating immune imbalance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] 1. Expression and purification of novel coronavirus 3CLPro protein
[0035] 1.1 Primer Design
[0036]Gene-specific primers (3CL-F: gtgccgcgcggcagccatatgtcggcagtgctgcaaagcggtttccgtaagatg, SEQ ID NO: 1; 3CL-R: gtggtggtggtggtgctcgaggggcccttgaaaggtcacacaccgcgcgcgcgcgcttgaaaggtcacac) were designed according to the gene of novel coronavirus 3CLPro (protein residues 3264-3569 of ORF1ab, GenBank accession number: MN908947.3). , SEQ ID NO: 2), wherein the 3CLPro-F primer sequence has an NdeI restriction site, and the 3CLPro-R primer sequence has an XhoI restriction site. Add 5 amino acids of SAVLQ to the N-terminus of the protein to construct a 3CLPro self-enzyme cleavage site; add two amino acids of GP after the VTFQ amino acid of the C-terminus of the protein to construct a Precision protease cleavage site to promote the fusion expression of the target gene and the His tag.
[0037] 1.2 Amplification of novel coronavirus 3CLPro gene
[0038] The novel coronavirus 3CLPro gen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


