Detection kit for citalopram and escitalopram metabolic markers and detection method and application thereof
A technology of metabolic markers and detection kits, which is applied in the field of gene detection, can solve the problems of large individual differences in the efficacy of citalopram, and achieve the effects of improving heat transfer efficiency, temperature consistency, and temperature change speed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1, the preparation of kit
[0045] The kit of the present invention designs specific amplification primers and sequencing primers for CYP2C19 (681G>A) and CYP2C19 (636G>A) for amplification and pyrosequencing detection. Designing primers based on rapid amplification technology is one of the keys of the present invention, and the sequence of gene polymorphism is subject to the public sequence in Genebank.
[0046] (1) The primer sequences of this embodiment are as follows:
[0047] Primer name SEQ ID Sequence (5'~3') modify CYP2C19(681G>A) front primer 1 ACCAGAGCTTGGCATATTGTATC 5`Biotin Primer behind CYP2C19(681G>A) 2 CAAATACGCAAGCAGTCACATAA CYP2C19(636G>A) front primer 3 CTCCCTGCAATGTGATCTGCT Primer behind CYP2C19(636G>A) 4 AAATGTACTTCAGGGCTTGGTC 5`Biotin CYP2C19(681G>A) Sequencing Primers 5 GTAATTTGTTATGGGTTCC CYP2C19(636G>A) Sequencing Primers 6 GGATTGTAAGCACCCC CYP2C19(681G>A) ...
Embodiment 2
[0054] Embodiment 2, pyrophosphate detection
[0055] The instruments adopted in the present invention are as follows: amplification instrument, pyrosequencer (Wuhan First Biotechnology Co., Ltd.).
[0056] (1) Reagent preparation (reagent preparation room)
[0057] Take out the reagents in advance, vortex the PCR reaction solution for 15 seconds, and centrifuge at low speed for later use. . Determine the number of reactions N, N = number of samples to be tested (n) + number of quality control products (1) + blank control. It is recommended to conduct positive control and blank control analysis for each PCR experiment at the same time. Then the reaction solution was dispensed into PCR reaction tubes at 16 μL / tube.
[0058] (2) Sample testing (sample preparation room)
[0059] Add EDTA anticoagulated whole blood, positive control and blank control into the PCR reaction tube according to the sample volume of 4 μL, close the tube cap tightly, centrifuge at low speed for 15 s...
PUM
| Property | Measurement | Unit |
|---|---|---|
| thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



