Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene polymorphism detection kit for vitamin D metabolism marker and detection method and application thereof

A technology for metabolic markers and gene polymorphisms, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc. question

Inactive Publication Date: 2021-11-19
上海普然生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the sequencing method and the chip method have cumbersome operation steps, long detection cycle, and the amplification product is prone to contamination; the high-resolution melting curve method has simple steps, low specificity, and high requirements for equipment; The specific amplification method uses ARMS primers for specific amplification, and the design of the primers is difficult to optimize, and the detection conditions are strict.
Taqman fluorescent probe method has high test cost, and the amplification throughput of multiple genes is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene polymorphism detection kit for vitamin D metabolism marker and detection method and application thereof
  • Gene polymorphism detection kit for vitamin D metabolism marker and detection method and application thereof
  • Gene polymorphism detection kit for vitamin D metabolism marker and detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the preparation of kit

[0041] The rapid reaction kit of the present invention designs specific amplification primers and sequencing primers for VDR (FokI) and VDR (BsmI) for amplification and pyrosequencing detection. Designing primers based on rapid amplification technology is one of the keys of the present invention. In order to ensure the amplification speed and detection sensitivity, the amplification length should be controlled at 60-90bp. Gene polymorphism sequence is subject to the public sequence in Genebank.

[0042] (1) The primer sequences of this embodiment are as follows:

[0043] Primer name SEQ ID Sequence (5'~3') modify VDR(FokI) pre-primer 1 CAGCTGGCCCTGGCACTGA VDR(FokI) Back Primer 2 AGGGAAGTGCTGGCCGCCAT 5`Biotin VDR(BsmI) front primer 3 AGTGTGCAGGCGATTCGTA 5`Biotin Primer after VDR(BsmI) 4 GTTCACGCAAGAGCAGAGCC VDR(FokI) sequencing primer 5 CTTGCTGTTTCTTACAGG VDR(Bs...

Embodiment 2

[0050] Embodiment 2, pyrophosphate detection

[0051] The instruments adopted in the present invention are as follows: amplification instrument, pyrosequencer (Wuhan First Biotechnology Co., Ltd.). (1) Reagent preparation (reagent preparation room)

[0052] Take out the reagents in advance, vortex the PCR reaction solution for 15 seconds, and centrifuge at low speed for later use. Determine the number of reactions N, N = number of samples to be tested (n) + number of quality control products (1) + blank control. It is recommended to conduct positive control and blank control analysis for each PCR experiment at the same time. Then the reaction solution was dispensed into PCR reaction tubes at 16 μL / tube. The sealing film of the PCR tube used in the amplification has a concave design matching the heating column at the PCR reaction hole, and its thickness is 85 μm, which has a high degree of fit and fast heat transfer. More preferably, the sealing film of the PCR tube is pene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene polymorphism detection kit for a vitamin D metabolism marker and a detection method and application thereof. The marker for vitamin D metabolism is the polymorphism of two genes VDR and VDR, and the kit designs a specific amplification primer and a sequencing primer aiming at the polymorphism of two genes VDR FokI and VDR BsmI. The kit comprises the following components: an amplification reaction solution, a VDR FokI sequencing primer, a VDR BsmI sequencing primer and a positive control. The gene polymorphism related to calcium absorption and utilization capacity detection is detected by combining blood direct expansion, rapid amplification and optimized pyrosequencing technologies, and suggestions from the gene perspective are provided for clinical use of calcium absorption and utilization.

Description

technical field [0001] The invention relates to a gene polymorphism detection kit for vitamin D metabolic markers, a detection method and application thereof, and belongs to the field of gene detection. Background technique [0002] Vitamin D exists in some natural foods. Cholesterol in the human body can also be converted into vitamin D after being irradiated by ultraviolet rays. Vitamin D and its derivatives produced in the metabolic process are of great significance to the metabolism of calcium, phosphorus and bone in our body. Its metabolic derivative 1,25-dihydroxyvitamin D can make the calcium channel in the small intestinal mucosa highly expressed , so that calcium can be absorbed in large quantities. At the same time, 1,25-dihydroxyvitamin D can promote the maturation of osteoclasts as soon as possible. Mature osteoclasts release calcium and phosphorus in the bones into the blood, maintain appropriate calcium and phosphorus concentrations in the blood, and ensure ad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
Inventor 孙悦刘丹周虹桥
Owner 上海普然生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com