Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method of trivalent recombinant adenovirus vaccine

A technology for recombining adenovirus and foot-and-mouth disease virus, which is applied in the field of genetic engineering technology and immunology, and can solve the problems of difficulty in completely expressing the antigenic gene of the structural protein of foot-and-mouth disease virus and limited capacity

Pending Publication Date: 2022-01-07
JIAXING ANYU BIOTECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the limited capacity of adenovirus type 5 on the market for inserting foreign genes, it is difficult to fully express three independent FMD virus structural protein antigen genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method of trivalent recombinant adenovirus vaccine
  • Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method of trivalent recombinant adenovirus vaccine
  • Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method of trivalent recombinant adenovirus vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0106] The construction of the adenoviral vector plasmid of embodiment 1 deletion E1 and E3 gene

[0107] In A549 cells ( CCL-185) to amplify wild-type human adenovirus type 5 ( VR-1516, gene sequence AC_000008.1) virus, collect and concentrate the virus liquid, use the HirtVirual DNA Extract method to extract the adenovirus genome, use the cosmid method to construct the linear hAd5 genome into a circular supercos-Ad5 vector plasmid, use CRISPR / cas9 excises the E1 region of hAd5 adenovirus, and the designed gRNA is as follows:

[0108] hAd5-E1 upstream gRNA:

[0109] GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0110] hAd5-E1 downstream gRNA:

[0111] GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0112] Design gRNA sites in the upstream and downstream of the hAd5 E1 region, recover the large fragment vector after cutting, design primers, insert the ITR and PI...

Embodiment 2

[0118] Example 2 Construction of Adenoviral Vector Plasmid pAd5△E4 Deleting E1, E3 and E4 Genes

[0119] Using the carrier plasmid obtained in Example 1 that has knocked out the E1 and E3 genes, further knocking out the E4 gene can increase the capacity of the adenovirus vector and reduce its immunogenicity. At the same time, foreign genes can be inserted in the E4 region. The source gene can be expressed in large quantities at the E4 position without affecting the packaging of the adenocarcinoma vector. Expressing foreign genes at the E1 and E4 genes can avoid the mutual interference of multiple foreign genes expressed in the same region, which is more conducive to expression; at the same time, unnecessary E4-related genes are reduced, and the immunogenicity of adenovirus is reduced. The adenovirus can exist in the host cell for a relatively long time, and the foreign gene can be expressed for a long time.

[0120] In order to completely knock out the E4 gene and facilitate ...

Embodiment 3

[0200] The construction of embodiment 3 foot-and-mouth disease adenovirus type 5 carrier E1 region shuttle plasmid pS5E1-A-OBY

[0201] 1. Construction of the shuttle plasmid in the E1 region of the human adenovirus type 5 vector

[0202] The backbone of the shuttle plasmid pS5E1 uses basic elements such as puc origin and amp (2796bp) (the pS5E1 backbone is synthesized by Beijing Bomaide Gene Technology Co., Ltd.), Ad5 left arm ITR partial sequence (355bp), right arm PIX, PIVa2 partial sequence (2100bp ), and CMV-MCS (944bp) SV40 early polyA (160bp).

[0203] 1) Gene synthesis

[0204] The pS5E1 backbone (2796bp) was synthesized by Biomed;

[0205] 2) Primer design

[0206] puc-Ad5-right arm-F: TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT

[0207] Ad5-right arm-CMV-R: ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATAAG

[0208] CMV-F: GTATCTGCTCCCTGCTTGTG

[0209] CMV-SV40-R: TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG

[0210] SV40-F: CTTCGCCCACCCCAACTTGT

[0211] SV40-R: AGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a trivalent recombinant adenovirus vaccine for foot-and-mouth disease and a construction method of the trivalent recombinant adenovirus vaccine. The trivalent recombinant adenovirus vaccine is obtained by constructing a recombinant adenovirus vector co-expressed by three antigen genes of a foot-and-mouth disease virus and packaging the recombinant adenovirus vector by AY293-6015 cells, and the trivalent recombinant adenovirus vaccine can be used for simultaneously preventing three serotype foot-and-mouth diseases. E1, E3 and E4 genes of an adenovirus vector are knocked out through CRISPR, and shuttle plasmids in E1 and E4 regions are constructed and are separately used for expressing A-P12A, OBY-P12A and OXJ-P12A-3C-mutant genes; and three foot-and-mouth disease virus structural proteins share one 3C protease to form a VLP, compared with a first-generation adenovirus vector, the vector capacity is increased by about 3kb, a recombinant adenovirus with high titer can be obtained, and the vaccine capacity can be greatly improved when the recombinant adenovirus vector is used for preparing a recombinant adenovirus vaccine for the foot-and-mouth disease. Due to a mode of simultaneously expressing independent-complete-structure protein antigens of three foot-and-mouth disease epidemic strains on one adenovirus vector, foot-and-mouth disease virus A type, O type BY strains and O type XJ strains can be simultaneously prevented, and the specific immune response to the foot-and-mouth disease virus can be enhanced.

Description

[0001] This application claims the priority of an earlier Chinese application, application number: 2020106427453, with an application date of July 6, 2020; this application claims the priority of an earlier Chinese application, application number: 202010672847. rights; all of its contents are part of the present invention. technical field [0002] The invention relates to the technical fields of genetic engineering and immunology, in particular to a foot-and-mouth disease trivalent recombinant adenovirus vaccine and a construction method thereof. Background technique [0003] Foot-and-mouth disease (FMD) is an acute and severe infectious disease of animals caused by foot-and-mouth disease virus (FMDV). It mainly harms cloven-hoofed animals such as pigs, cattle, and sheep. can cause huge economic losses. [0004] There are seven serotypes of FMD virus: O, A, C, SAT1, SAT2, SAT3 (namely South Africa 1, 2, 3) and Asia1 (Asia 1). There is almost no immune protection between th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/42C12N15/64A61K39/135A61K39/39A61P31/14
CPCC12N15/86C07K14/005C12N9/22A61K39/12A61K39/39A61P31/14C12N2710/10343C12N2710/10322C12N2710/10352C12N2800/50C12N2800/107C12N2770/32122C12N2770/32134A61K2039/5256A61K2039/53A61K2039/552A61K2039/55516
Inventor陈平钟鑫涛张婷婷李娜祝志刚李楠
OwnerJIAXING ANYU BIOTECH CO LTD