Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method of trivalent recombinant adenovirus vaccine
A technology for recombining adenovirus and foot-and-mouth disease virus, which is applied in the field of genetic engineering technology and immunology, and can solve the problems of difficulty in completely expressing the antigenic gene of the structural protein of foot-and-mouth disease virus and limited capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0106] The construction of the adenoviral vector plasmid of embodiment 1 deletion E1 and E3 gene
[0107] In A549 cells ( CCL-185) to amplify wild-type human adenovirus type 5 ( VR-1516, gene sequence AC_000008.1) virus, collect and concentrate the virus liquid, use the HirtVirual DNA Extract method to extract the adenovirus genome, use the cosmid method to construct the linear hAd5 genome into a circular supercos-Ad5 vector plasmid, use CRISPR / cas9 excises the E1 region of hAd5 adenovirus, and the designed gRNA is as follows:
[0108] hAd5-E1 upstream gRNA:
[0109] GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
[0110] hAd5-E1 downstream gRNA:
[0111] GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
[0112] Design gRNA sites in the upstream and downstream of the hAd5 E1 region, recover the large fragment vector after cutting, design primers, insert the ITR and PI...
Embodiment 2
[0118] Example 2 Construction of Adenoviral Vector Plasmid pAd5△E4 Deleting E1, E3 and E4 Genes
[0119] Using the carrier plasmid obtained in Example 1 that has knocked out the E1 and E3 genes, further knocking out the E4 gene can increase the capacity of the adenovirus vector and reduce its immunogenicity. At the same time, foreign genes can be inserted in the E4 region. The source gene can be expressed in large quantities at the E4 position without affecting the packaging of the adenocarcinoma vector. Expressing foreign genes at the E1 and E4 genes can avoid the mutual interference of multiple foreign genes expressed in the same region, which is more conducive to expression; at the same time, unnecessary E4-related genes are reduced, and the immunogenicity of adenovirus is reduced. The adenovirus can exist in the host cell for a relatively long time, and the foreign gene can be expressed for a long time.
[0120] In order to completely knock out the E4 gene and facilitate ...
Embodiment 3
[0200] The construction of embodiment 3 foot-and-mouth disease adenovirus type 5 carrier E1 region shuttle plasmid pS5E1-A-OBY
[0201] 1. Construction of the shuttle plasmid in the E1 region of the human adenovirus type 5 vector
[0202] The backbone of the shuttle plasmid pS5E1 uses basic elements such as puc origin and amp (2796bp) (the pS5E1 backbone is synthesized by Beijing Bomaide Gene Technology Co., Ltd.), Ad5 left arm ITR partial sequence (355bp), right arm PIX, PIVa2 partial sequence (2100bp ), and CMV-MCS (944bp) SV40 early polyA (160bp).
[0203] 1) Gene synthesis
[0204] The pS5E1 backbone (2796bp) was synthesized by Biomed;
[0205] 2) Primer design
[0206] puc-Ad5-right arm-F: TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT
[0207] Ad5-right arm-CMV-R: ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATAAG
[0208] CMV-F: GTATCTGCTCCCTGCTTGTG
[0209] CMV-SV40-R: TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG
[0210] SV40-F: CTTCGCCCACCCCAACTTGT
[0211] SV40-R: AGA...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com