Recombinant adenovirus vaccine for African swine fever and construction method of recombinant adenovirus vaccine

A technology of African swine fever virus and recombinant adenovirus, applied in the field of genetic engineering technology and immunology

Pending Publication Date: 2022-01-07
JIAXING ANYU BIOTECH CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no recombinant adenoviral vector co-expressing the four antigen genes in the prior art, and there is no recombinant adenoviral vector co-expressing the four antigen genes P72, B602L, P30, and P54 of ASFV and applied to live vector vaccines. to develop

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus vaccine for African swine fever and construction method of recombinant adenovirus vaccine
  • Recombinant adenovirus vaccine for African swine fever and construction method of recombinant adenovirus vaccine
  • Recombinant adenovirus vaccine for African swine fever and construction method of recombinant adenovirus vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135] Example 1 Construction of Adenoviral Vector Plasmid pAd5 Deleting E1 and E3 Genes

[0136] in A549 cells Amplified wild-type human adenovirus type 5 ( VR-1516, gene sequence AC_000008.1) virus, collect and concentrate the virus liquid, use the HirtVirual DNA Extract method to extract the adenovirus genome, use the cosmid method to construct the linear hAd5 genome into a circular supercos-Ad5 vector plasmid, use CRISPR / cas9 excises the E1 region of hAd5 adenovirus, and the designed gRNA is as follows:

[0137] hAd5-E1 upstream gRNA:

[0138] GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0139] hAd5-E1 downstream gRNA:

[0140] GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0141] Design gRNA sites in the upstream and downstream of the hAd5 E1 region, recover the large fragment vector after cutting, design primers, insert the ITR and PIX sequences into the...

Embodiment 2

[0147] Example 2 Construction of Adenoviral Vector Plasmid pAd5ΔE4 Deleting E1, E3 and E4 Genes

[0148] Using the carrier plasmid pAd5 obtained in Example 1 that has knocked out the E1 and E3 genes, further knocking out the E4 gene can increase the capacity of the adenovirus vector and reduce its immunogenicity, and use PCR to amplify part of the fiber and Introduce the NdeI single restriction site, and then use Gibson's seamless cloning method to connect the redundant excised fragments to the vector to obtain a vector plasmid that deletes the E1, E3 and E4 genes and introduces the SwaI and I-sceI restriction sites pAd5ΔE4.

[0149] 1. Selection of target gene E4 CRISPR target sequence

[0150] 1) Selection of CRISPR target sequence of fiber gene upstream of E4 gene

[0151] Using Thermo Fisher GeneArt TM The CRISPR Search and Design tool (thermofisher.com / crisprdesign) software inputs the first 400 bases of the fiber gene, and the software automatically analyzes the seque...

Embodiment 3

[0228] Example 3 Construction of Adenoviral Vector Plasmid pAd5LCL3 Deleting E1, E3, E4 and E2a Genes

[0229] 1. Selection of target gene E2a CRISPR target sequence

[0230] 1) Selection of CRISPR target sequence of 100k genes upstream of E2a gene

[0231] Using Thermo Fisher GeneArt TM CRISPR Search and Design tool (thermofisher.com / crisprdesign) software, input the first 400 bases of 100k genes, the software automatically analyzes the sequence of 400 bases, and provides 6 potential CRISPR target sequences. Considering the length of the E2a gene knockout sequence and the requirements for constructing live vectors, ATAGGTGGCGTTCGTAGGCA was selected as the targeting sequence, and the finally obtained gRNA was named 100k-gRNA, and the cleavage site and PAM site were as follows: Figure 8 shown.

[0232] 2) Selection of CRISPR target sequences in the downstream non-coding sequence of E2a

[0233] Using Thermo Fisher GeneArt TM CRISPR Search and Design tool (thermofisher.com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an African swine fever virus vaccine. The vaccine is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of an African swine fever virus and packaging the recombinant adenovirus vector through 293TD37 cells. Wherein the four antigen genes of the African swine fever virus are P72, B602L, P30 and P54 respectively. The construction of the recombinant adenovirus vector co-expressed by the four antigen genes of the African swine fever virus mainly comprises the following steps: knocking out E1, E3, E2a and E4 genes of an adenovirus vector through CRISPR / cas9 to construct shuttle plasmids in E1 and E4 regions, and respectively expressing the P72, B602L, P30 and P54 genes by using the shuttle plasmids, thereby obtaining a brand-new adenovirus vector. Compared with a first-generation adenovirus vector, the vector has the advantages that the vector capacity is increased by about 3kb, and the recombinant adenovirus with relatively high titer is obtained by carrying out packaging through a 293TD37 cell line and is used for preparing a recombinant adenovirus vaccine for an African swine fever. According to the African swine fever virus vaccine, the capacity of the adenovirus vector vaccine can be greatly increased, and the specific immune response to the African swine fever virus is enhanced by simultaneously expressing four independent antigens of the African swine fever on one adenovirus vector.

Description

[0001] This application claims the priority of an earlier Chinese application, application number: 2020106427453, with an application date of July 6, 2020; all its contents are regarded as a part of the present invention. technical field [0002] The invention relates to the technical fields of genetic engineering and immunology, in particular to a recombinant adenovirus vaccine of African swine fever virus and a construction method thereof. Background technique [0003] African swine fever (ASF) is a highly contagious viral disease of swine. It can lead to high mortality close to 100% in domestic pigs. ASF is caused by ASF virus (ASFVirus, ASFV). ASFV is a large double-stranded DNA virus that mainly replicates in the cytoplasm of macrophages. 190kb, containing 151 open reading frames, which can encode 150-200 kinds of proteins, double-stranded linear DNA virus with envelope. The structural proteins that make up ASFV virions include P30, P72, P49, P54, P220, P62, pB602L, C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/34C12N15/64C12N15/55A61K39/12A61P31/20
CPCC12N15/86C07K14/005C12N9/22A61K39/12A61P31/20C12N2710/10343C12N2710/10322C12N2710/10352C12N2800/50C12N2800/107C12N2710/12022C12N2710/12034A61K2039/5256A61K2039/53A61K2039/552Y02A50/30
Inventor陈平李娜张婷婷钟鑫涛祝志刚张利娟李娅芳李楠
OwnerJIAXING ANYU BIOTECH CO LTD