Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gene enhanced immune cells in lung cancer

An immune cell, enhanced technology, applied in the field of immunology, can solve the problems of difficult expansion of NK cells and insufficient killing ability, and achieve the effect of improving the proliferation ability and enhancing the killing activity.

Active Publication Date: 2022-01-14
青岛西凯生物技术有限公司
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, NK cells have the shortcomings of difficult expansion and insufficient killing ability, so effectively solving these two shortcomings can effectively improve the application of NK cells in the treatment of lung cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene enhanced immune cells in lung cancer
  • Application of gene enhanced immune cells in lung cancer
  • Application of gene enhanced immune cells in lung cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] siRNA of lnc-AL592494.1 promotes NK cell proliferation

[0023] (1) According to the cDNA sequence SEQ ID NO.1 of lnc-AL592494.1 to design lnc-AL592494.1 siRNA, the designed si-lnc-AL592494.1 sequence is as follows:

[0024] The sense strand sequence of si-lnc-AL592494.1 is: AUUACAUAUGUAACAAUAC, SEQ ID NO.2;

[0025] The antisense strand sequence of si-lnc-AL592494.1 is: GUAUUGUUACAUAUGUAAU, SEQ ID NO.3;

[0026] (2) Transfect si-NC and si-lnc-AL592494.1 into NK-92 cells,

[0027] (3) After 48 hours of transfection, extract RNA and detect the expression of lnc-AL592494.1. The primer sequences are as follows:

[0028] Upstream primer: TCACGCATTCATGATTCACTGA, SEQ ID NO.4;

[0029] Downstream primer: TTGCTGGCCTATGGAATGCA, SEQ ID NO.5;

[0030] (4) Prepare the transfected NK cells into a cell suspension and inoculate them in a cell culture plate, 500 cells per well, and set 5 duplicate wells for si-NC and si-lnc-AL592494.1 respectively;

[0031] (5) After culturing for...

Embodiment 2

[0036] siRNA of lnc-AL592494.1 promotes expression of GraB (granzyme B) and PFP (perforin) in NK cells

[0037] 1. Protein extraction

[0038] (1) Collect NK cells transfected for 48 hours into a centrifuge tube, remove the medium by centrifugation, wash with PBS, and add protein lysate;

[0039] (2) After fully lysing for 30 minutes, place the centrifuge tube in a centrifuge and absorb the supernatant into a new centrifuge tube;

[0040] (3) Refer to the instructions of the BCA protein concentration detection kit to detect the protein concentration, add loading buffer to adjust to a uniform concentration, and then put the protein sample in boiling water for 5 minutes to obtain the final protein sample;

[0041] 2. Western blot detection

[0042] (1) Configure the electrophoresis gel, install the electrophoresis rack, spot the protein sample and protein marker, turn on the electrophoresis instrument and adjust it to a constant voltage of 90V for electrophoresis;

[0043] (2...

Embodiment 3

[0049] siRNA of lnc-AL592494.1 promotes the killing activity of NK cells against lung cancer cell A549

[0050] (1) NK cells transfected with si-NC and si-lnc-AL592494.1 were prepared to 2×10 6 / ml cell suspension, as effector cells;

[0051] (2) Make lung cancer A549 cells into 2×10 5 / ml cell suspension, as target cells;

[0052] (3) Mix 1.5ml of A549 cells with 1.5ml of si-NC cells and 1.5ml of si-lnc-AL592494.1 cells respectively;

[0053] (4) Simultaneously set effector cells and target cell natural release holes, target cell maximum release holes and medium natural release holes;

[0054](4) After mixing, culture the cells in a cell incubator for 4 hours, then centrifuge them in a centrifuge for 10 minutes, and collect the supernatant;

[0055] (5) After the end, absorb 50ul of LDH enzyme reaction solution and 50ul of supernatant in each well and add it to a 96-well plate. After reacting at room temperature in the dark for 30 minutes, add 50ul of reaction termination...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of gene enhanced immune cells in lung cancer, and belongs to the technical field of immunology. The gene enhanced immune cells provided by the invention are NK (Natural Killer) cells transfected with siRNA (Small Interference Ribonucleic Acid) of lnc-AL592494.1. The NK cells provided by the invention have stronger multiplication capacity, and have stronger killing activity on lung cancer cells.

Description

technical field [0001] The invention belongs to the technical field of immunology, and in particular relates to the application of gene-enhanced immune cells in lung cancer. Background technique [0002] Natural killer cells (NK cells) are the main natural immune system lymphocytes in the body discovered by Rolf Kiessling and Ronald Heberman in the 1970s. As a large group of lymphocytes juxtaposed with T cells and B cells, they are natural Important member of the immune system. NK cells play an important role in resisting infection by foreign pathogens and clearing up malignant cancer cells. NK does not require antigen sensitization and MHC restriction in the recognition and killing of tumor cells, and can secrete a variety of cytokines and chemokines to regulate the immune response, so NK plays an important role in the cellular immunotherapy of tumors. [0003] Lung cancer is the most common malignant tumor in my country, and lung cancer is one of the malignant tumors wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/17A61K31/713A61P35/00C12N15/113C12N5/10C12N5/0783
CPCC12N15/113C12N5/0646A61K35/17A61K31/713A61P35/00C12N2310/141
Inventor 沈晓延曲青梅相爱玲
Owner 青岛西凯生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com