Application of gene enhanced immune cells in lung cancer
An immune cell, enhanced technology, applied in the field of immunology, can solve the problems of difficult expansion of NK cells and insufficient killing ability, and achieve the effect of improving the proliferation ability and enhancing the killing activity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] siRNA of lnc-AL592494.1 promotes NK cell proliferation
[0023] (1) According to the cDNA sequence SEQ ID NO.1 of lnc-AL592494.1 to design lnc-AL592494.1 siRNA, the designed si-lnc-AL592494.1 sequence is as follows:
[0024] The sense strand sequence of si-lnc-AL592494.1 is: AUUACAUAUGUAACAAUAC, SEQ ID NO.2;
[0025] The antisense strand sequence of si-lnc-AL592494.1 is: GUAUUGUUACAUAUGUAAU, SEQ ID NO.3;
[0026] (2) Transfect si-NC and si-lnc-AL592494.1 into NK-92 cells,
[0027] (3) After 48 hours of transfection, extract RNA and detect the expression of lnc-AL592494.1. The primer sequences are as follows:
[0028] Upstream primer: TCACGCATTCATGATTCACTGA, SEQ ID NO.4;
[0029] Downstream primer: TTGCTGGCCTATGGAATGCA, SEQ ID NO.5;
[0030] (4) Prepare the transfected NK cells into a cell suspension and inoculate them in a cell culture plate, 500 cells per well, and set 5 duplicate wells for si-NC and si-lnc-AL592494.1 respectively;
[0031] (5) After culturing for...
Embodiment 2
[0036] siRNA of lnc-AL592494.1 promotes expression of GraB (granzyme B) and PFP (perforin) in NK cells
[0037] 1. Protein extraction
[0038] (1) Collect NK cells transfected for 48 hours into a centrifuge tube, remove the medium by centrifugation, wash with PBS, and add protein lysate;
[0039] (2) After fully lysing for 30 minutes, place the centrifuge tube in a centrifuge and absorb the supernatant into a new centrifuge tube;
[0040] (3) Refer to the instructions of the BCA protein concentration detection kit to detect the protein concentration, add loading buffer to adjust to a uniform concentration, and then put the protein sample in boiling water for 5 minutes to obtain the final protein sample;
[0041] 2. Western blot detection
[0042] (1) Configure the electrophoresis gel, install the electrophoresis rack, spot the protein sample and protein marker, turn on the electrophoresis instrument and adjust it to a constant voltage of 90V for electrophoresis;
[0043] (2...
Embodiment 3
[0049] siRNA of lnc-AL592494.1 promotes the killing activity of NK cells against lung cancer cell A549
[0050] (1) NK cells transfected with si-NC and si-lnc-AL592494.1 were prepared to 2×10 6 / ml cell suspension, as effector cells;
[0051] (2) Make lung cancer A549 cells into 2×10 5 / ml cell suspension, as target cells;
[0052] (3) Mix 1.5ml of A549 cells with 1.5ml of si-NC cells and 1.5ml of si-lnc-AL592494.1 cells respectively;
[0053] (4) Simultaneously set effector cells and target cell natural release holes, target cell maximum release holes and medium natural release holes;
[0054](4) After mixing, culture the cells in a cell incubator for 4 hours, then centrifuge them in a centrifuge for 10 minutes, and collect the supernatant;
[0055] (5) After the end, absorb 50ul of LDH enzyme reaction solution and 50ul of supernatant in each well and add it to a 96-well plate. After reacting at room temperature in the dark for 30 minutes, add 50ul of reaction termination...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


