Unlock instant, AI-driven research and patent intelligence for your innovation.

Compositions and methods for treating glycogen storage disease type 1a

A glycogen storage disease, glucose technology, used in the treatment of type 1a glycogen storage disease, and adenosine deaminase domain, related to GSD1a, can solve problems such as no approved therapy yet

Pending Publication Date: 2022-02-08
BEAM THERAPEUTICS INC
View PDF38 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although liver transplantation is curative, there are no approved therapies and current treatment options involve almost exclusively continuous cornstarch feeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for treating glycogen storage disease type 1a
  • Compositions and methods for treating glycogen storage disease type 1a
  • Compositions and methods for treating glycogen storage disease type 1a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1307] Example 1. Gene Editing to Correct the Q347X Mutation of Glycogen Storage Disease Type 1A (Von Gilke Disease) in HEK293T Cells

[1308] Example 1. Base editing strategy for 1Q347X mutation correction.

[1309] GSD1a is caused by mutations in the glucose 6-phosphatase (G6PC) gene, which affects approximately 80 percent of people with GSD1. The Q347X mutation affects approximately 500 US patients diagnosed with GSD1a each year. This mutation is a single base substitution that introduces a stop codon that terminates prematurely at position 347 (Q347X) of the G6PC protein. Precise correction of Q347X may restore G6PC expression and normalize glucose metabolism.

[1310] Adenosine base editors (ABEs) employing Cas9 moieties and validated protospacer-adjacent motif (PAM) sequence preferences were evaluated for their ability to correct the Q347X mutation by efficiently switching A>G at the target site. Representative G6PC nucleotide target sequences and corresponding amino ...

Embodiment 16

[1346] Example 1.6 Accurate correction in heterozygous patient iPSc-derived Q347X hepatocytes.

[1347] Precise on-target base editing was tested using heterozygous patient iPSc-derived human hepatocytes (Definigen, Hep GSD1a lots 493, 507 and 518). The GSD1a iPSc-derived hepatocytes were compound heterozygous (Q347X / G222R) and carried the Q347X mutation.

[1348] The target / spacer sequence of the Q347X mutation is shown in Figure 6A . The target / spacer sequence is shown at target and bystander "a" nucleobases. The Q347X mutation can be targeted using NGA PAM variants such as GGA.

[1349] The gRNA sequence hybridizes to the complement of the G6PC DNA target sequence as follows:

[1350] GACCTAGGCGAGGCAGTAGG GGA

[1351] The NGA PAM sequence (i.e. SpCas9) is underlined.

[1352] The gRNA scaffold sequence is as follows:

[1353] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[1354] Percentage of on-target and bystander A>G base e...

Embodiment 2

[1365] Example 2. In vitro transduction of GSD1A mutant primary hepatocyte co-culture system Example 2.1 Co-culture system and transduction method.

[1366]Base editing was tested using an in vitro transduction approach in a primary hepatocyte co-culture system. To generate a co-culture system, primary human hepatocytes (PHH) (BioIVT) were seeded at 350k cells per well in type I collagen-coated 24-well plates (Corning, 354408) and incubated at 37°C in 5% A monolayer of adherent cells was produced under carbon dioxide. Four hours after plating, the plated hepatocytes were washed with CP medium (BioIVT) to remove any non-adherent cells. 3T3-J2 mouse embryonic fibroblasts (Kerafast (distributed from Howard Green (Harvard), Boston)) were seeded at a ratio of 95% hepatocytes:5% fibroblasts / well and re-cultured at 37°C, 5% CO2 12 hours to form a co-culture. Change the medium (500 μL per well) every 2 days for continuous maintenance. Figure 8B Shown are images of transduced prima...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides compositions comprising novel adenosine base editors (e.g., ABE8) that have increased efficiency and methods of using base editors comprising adenosine deaminase variants for altering mutations associated with Glycogen Storage Disease Type 1a (GSD1a).

Description

[0001] Cross References to Related Applications [0002] This application is an International PCT (Internatinoal PCT) application, claiming U.S. Provisional Application No. 62 / 805,271, filed February 13, 2019; 62 / 852,228, filed May 23, 2019; filed in 2019 No. 62 / 852,224, filed May 23; No. 62 / 876,354, filed July 19, 2019; No. 62 / 912,992, filed October 9, 2019; filed November 6, 2019 62 / 931,722, filed November 27, 2019; and 62 / 966,526, filed January 27, 2020, the entire contents of which are incorporated by reference in their entirety into this article. [0003] citation [0004] All publications, patents and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N15/113C12N15/10C12N9/78C12N9/22C12N5/10A61K48/00A61K38/50A61K38/46A61P3/08
CPCC12N9/22C12N2310/20C12N15/1137C12N2320/34C12Y301/03009C12Y305/04004C12N15/102C12N9/78C07K2319/80C07K2319/09C12N15/90C12N9/16A61K31/7105
Inventor N·戈代尔利M·帕克I·斯雷梅克Y·于B·蔡澈Y·阿拉泰恩F·葛瑞格尔G·伦格D·A·玻恩S-J·李
Owner BEAM THERAPEUTICS INC