Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Gene editing system and method for fixed-point insertion of exogenous gene

An exogenous gene and gene editing technology, applied in the field of biomedicine, can solve problems such as copy number and position instability, interference with experimental results, and pathogenicity. Simple and uniform background, clear and reliable effect of genetic background

Pending Publication Date: 2022-03-01
ASCLEPIUS SUZHOU TECH CO GRP CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the stable expression cell lines obtained by the above two methods all have random integration of the target gene in the chromosomal DNA, which can easily cause the loss of other gene functions, and the copy number and position of the insertion are not fixed.
Therefore, the expression differences between different cells in the same source cell line are more obvious, and there may be potential risks that interfere with the final experimental results. In immunotherapy, this random integration will also bring potential pathogenic and carcinogenic risks.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing system and method for fixed-point insertion of exogenous gene
  • Gene editing system and method for fixed-point insertion of exogenous gene
  • Gene editing system and method for fixed-point insertion of exogenous gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Design and synthesis of exogenous genes and sgRNA

[0043] 1. Design of sgRNA

[0044] Using CRISPR / Cas9 technology, for the AAVS1 region, use the Crisprgold website (https: / / crisprgold.mdc-berlin.de / index.php) to design sgRNA, the selected sgRNA sequence is shown in SEQ ID NO: 1 (GGGGCCACTAGGGACAGGAT).

[0045] 2. Target genome amplification

[0046] Take 1×10 6 Genomic DNA was extracted using Tiangen Cell Gene Extraction Kit (DP304), and genomic PCR amplification was performed using primers AAVS1-F1 (SEQ ID NO:5, GCCTCCCCTTCTTGTAGGCC) and AAVS1-R1 (SEQ ID NO:6, AGCCAAAGTTAGAACTCAGG) Then use the gel kit (Axygen: AP-GX-250) to cut the amplified fragment and recover the target fragment. The result is as follows: figure 1 shown, and the recovered target fragments were stored at -20°C until use.

[0047] 3. Preparation of AAVS1 insertion site sgRNA in vitro and verification of editing efficiency

[0048] sgRNA in vitro transcription: according to the selec...

Embodiment 2

[0052] Example 2: Site-directed insertion of exogenous genes into K562 cells

[0053] 1. K562 cell recovery culture

[0054] Turn on the water bath in advance, and set the temperature to 37°C, take out the IMDM-Full medium to preheat, take out the NK-92 cells from the liquid nitrogen tank, put them into the 37°C water bath immediately, take a 15ml centrifuge tube, add 8ml pre-heated Warmed K562 medium; place the cells in a 37°C water bath and shake gently until they are completely melted, wipe the outer wall of the cryovial with an alcohol-containing non-woven cloth, and slowly add the cell suspension to a 15ml centrifuge tube (this The process is controlled within 3 minutes), after mixing, centrifuge at 1000rpm for 5 minutes, discard the supernatant; take 1ml of medium to resuspend the cell pellet, transfer to a T75 culture flask containing 30mL IMDM-Full medium for culture, and carry out cell passage according to a certain density. Maintain proper cell growth density.

[0...

Embodiment 3

[0059] Example 3: Detection of electroporation efficiency of aAPC1 knock-in K562 cells

[0060] Take part of the K562 cells with aAPC1 knock-in after transfection for 24 hours in Example 2, transfer to a 15ml centrifuge tube, centrifuge at 1500rpm for 5min, discard the supernatant; add 1ml PBS to wash the cell pellet, transfer to a 1.5ml EP tube, Centrifuge at 1500rpm for 5min, discard the supernatant, repeat the operation once, use the flow cytometer (ACEA:NOVOCyte3130), select the FITC channel to detect the electroporation efficiency, the results are as follows Figure 4 As shown, it can be seen from the figure that the RNP complex electrotransfected K562 cells has a transfection efficiency of 49.71%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The embodiment of the invention discloses a gene editing system and method for fixed-point insertion of an exogenous gene, the gene editing system comprises Cas9, sgRNA and ssDNA, the Cas9 and the sgRNA form an RNP compound, the sgRNA is an insertion site of the exogenous gene, and the ssDNA is an insertion template of the exogenous gene. According to the invention, a gene editing technology is mainly utilized, ssDNA is utilized as an insertion template of an exogenous gene, and under the cooperation of sgRNA, 4.5 kb (aAPC1: EF1a-CD19-CD86-CD64-PolyA) fixed-point knock-in is successfully realized at an AAVS1 locus; the AAVS1 knock-in exogenous gene segment has the advantages of stable expression and no influence on transcription of other genes; therefore, the genetic background of the modified cells is simpler and more uniform, and the influence of insertion sites and copy numbers on other gene functions is eliminated.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, in particular to a gene editing system and method, in particular to a gene editing system and method for site-directed insertion of exogenous genes. Background technique [0002] Stable expression cell line, also known as stable transfection cell line, refers to the integration of specific gene plasmid DNA into the cell chromosome through molecular biology methods, so that the cell can express stably for a long time or interfere with gene expression. It is an important tool for gene function research, model establishment, and crop breeding , one of the most commonly used methods for drug development and gene therapy. [0003] The construction methods of traditional stable transfected cell lines can be divided into two categories: non-viral and viral. The construction of non-viral stably transfected cell lines is mainly through transfection of plasmids or transposons into cells by elec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N9/22C12N15/90C12N5/10
CPCC12N15/113C12N9/22C12N15/907C12N2310/20Y02A50/30
Inventor 栗凤鹏曹青李华顺
Owner ASCLEPIUS SUZHOU TECH CO GRP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com